Incidental Mutation 'G1citation:Kcnh7'
ID660718
Institutional Source Beutler Lab
Gene Symbol Kcnh7
Ensembl Gene ENSMUSG00000059742
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 7
SynonymsKv11.3, 9330137I11Rik, erg3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #G1citation (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location62693414-63184287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 62787904 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 414 (I414L)
Ref Sequence ENSEMBL: ENSMUSP00000108073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075052] [ENSMUST00000112452] [ENSMUST00000112454]
Predicted Effect probably damaging
Transcript: ENSMUST00000075052
AA Change: I414L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074563
Gene: ENSMUSG00000059742
AA Change: I414L

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Pfam:Ion_trans 407 674 4.9e-39 PFAM
Pfam:Ion_trans_2 588 668 3.2e-13 PFAM
cNMP 745 863 1.5e-23 SMART
low complexity region 921 940 N/A INTRINSIC
coiled coil region 1022 1058 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112452
AA Change: I407L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108071
Gene: ENSMUSG00000059742
AA Change: I407L

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Blast:MYSc 309 426 4e-24 BLAST
low complexity region 446 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112454
AA Change: I414L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108073
Gene: ENSMUSG00000059742
AA Change: I414L

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Blast:MYSc 316 433 3e-24 BLAST
low complexity region 453 468 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 G A 11: 102,776,675 R687Q possibly damaging Het
AI987944 A G 7: 41,374,808 L249P probably damaging Het
Ankrd28 T A 14: 31,736,840 probably null Het
Bahcc1 T C 11: 120,287,721 S2369P probably damaging Het
Birc6 T C 17: 74,580,382 S902P possibly damaging Het
Birc6 A T 17: 74,598,044 K1277N probably damaging Het
Brwd1 T C 16: 96,041,274 E821G probably benign Het
Cct8l1 T C 5: 25,517,939 S551P possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cyp2c39 A T 19: 39,536,817 D188V probably damaging Het
Dclk3 G T 9: 111,439,337 A25S probably benign Het
Dpep2 A T 8: 105,985,241 M518K probably benign Het
Dst T C 1: 34,275,674 V6462A probably damaging Het
Entpd3 T C 9: 120,562,038 probably null Het
Epm2aip1 T C 9: 111,272,556 V199A probably damaging Het
Fam193b A G 13: 55,541,691 probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fcgbp T A 7: 28,107,356 Y2250N probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
H2-Aa C T 17: 34,287,677 probably null Het
Igsf9 T A 1: 172,497,163 S883T possibly damaging Het
Kcnma1 T C 14: 24,003,744 probably null Het
Kcnmb1 T C 11: 33,964,686 probably benign Het
Kmt2d A G 15: 98,849,459 probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Nlgn1 T C 3: 26,133,647 T30A probably benign Het
Nucb1 A G 7: 45,498,865 F175L probably damaging Het
Pax6 T A 2: 105,685,923 V182E probably benign Het
Ptger1 A G 8: 83,668,650 D252G probably benign Het
Rexo4 T C 2: 26,960,271 D275G probably damaging Het
Ripk4 T C 16: 97,746,036 D342G probably damaging Het
Rpl10l A T 12: 66,284,213 C49S possibly damaging Het
Sema7a T C 9: 57,960,336 F457S probably damaging Het
Shank3 G A 15: 89,531,627 D155N probably damaging Het
Smpd3 G A 8: 106,265,964 probably benign Het
Smpd4 T C 16: 17,640,233 V465A probably damaging Het
Sohlh2 T C 3: 55,207,686 V364A probably damaging Het
Sos2 C T 12: 69,650,649 R99Q probably damaging Het
Spry2 G A 14: 105,893,357 Q132* probably null Het
Tbx19 G T 1: 165,140,140 P346Q probably damaging Het
Tdrd6 A G 17: 43,627,215 Y981H probably damaging Het
Tinag T C 9: 77,031,702 K165E probably benign Het
Tubb4a A T 17: 57,080,904 I374N probably damaging Het
Umodl1 C T 17: 30,986,554 Q708* probably null Het
Vmn2r3 A T 3: 64,287,455 V14E probably benign Het
Zfp82 G A 7: 30,056,287 L457F probably damaging Het
Other mutations in Kcnh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kcnh7 APN 2 62764691 missense probably benign 0.01
IGL00693:Kcnh7 APN 2 62734254 missense probably benign 0.06
IGL00776:Kcnh7 APN 2 62850376 missense probably benign 0.00
IGL00956:Kcnh7 APN 2 62777639 missense probably damaging 1.00
IGL01651:Kcnh7 APN 2 62734284 missense possibly damaging 0.47
IGL01780:Kcnh7 APN 2 62837163 missense probably benign 0.17
IGL01859:Kcnh7 APN 2 62721788 missense probably benign 0.00
IGL02213:Kcnh7 APN 2 62739362 missense probably damaging 1.00
IGL02302:Kcnh7 APN 2 62706058 missense probably damaging 1.00
IGL02526:Kcnh7 APN 2 62850437 missense possibly damaging 0.46
IGL02850:Kcnh7 APN 2 62787685 nonsense probably null
IGL02989:Kcnh7 APN 2 62721925 missense probably benign
IGL02990:Kcnh7 APN 2 62705986 missense probably benign 0.11
LCD18:Kcnh7 UTSW 2 63049799 intron probably benign
R0129:Kcnh7 UTSW 2 62716159 missense probably benign 0.00
R0622:Kcnh7 UTSW 2 62837289 splice site probably null
R0638:Kcnh7 UTSW 2 62777510 missense probably benign 0.13
R1006:Kcnh7 UTSW 2 62716183 missense probably benign 0.00
R1200:Kcnh7 UTSW 2 62777395 missense probably damaging 1.00
R1330:Kcnh7 UTSW 2 62777411 missense possibly damaging 0.56
R1614:Kcnh7 UTSW 2 62850604 missense probably benign 0.03
R1782:Kcnh7 UTSW 2 62736169 missense probably damaging 1.00
R1861:Kcnh7 UTSW 2 62777392 missense probably damaging 0.97
R1862:Kcnh7 UTSW 2 62787754 missense possibly damaging 0.46
R2197:Kcnh7 UTSW 2 62777606 missense probably damaging 1.00
R2510:Kcnh7 UTSW 2 62721917 missense probably benign
R2988:Kcnh7 UTSW 2 62721828 missense probably benign 0.20
R3024:Kcnh7 UTSW 2 62764663 missense probably damaging 1.00
R3433:Kcnh7 UTSW 2 62721917 missense probably benign
R4415:Kcnh7 UTSW 2 62706073 missense probably damaging 1.00
R4540:Kcnh7 UTSW 2 62739186 missense probably damaging 1.00
R4570:Kcnh7 UTSW 2 62837095 missense possibly damaging 0.91
R4827:Kcnh7 UTSW 2 62716220 missense probably benign
R4990:Kcnh7 UTSW 2 62734288 missense probably benign 0.00
R5172:Kcnh7 UTSW 2 62739164 missense possibly damaging 0.88
R5822:Kcnh7 UTSW 2 62716238 missense probably benign
R5996:Kcnh7 UTSW 2 63184097 start gained probably benign
R6142:Kcnh7 UTSW 2 62739360 missense possibly damaging 0.95
R6226:Kcnh7 UTSW 2 62777559 missense probably damaging 1.00
R6244:Kcnh7 UTSW 2 63182226 missense probably damaging 1.00
R6304:Kcnh7 UTSW 2 62764616 nonsense probably null
R6400:Kcnh7 UTSW 2 62739344 missense probably damaging 1.00
R6430:Kcnh7 UTSW 2 62850532 missense probably benign 0.04
R6483:Kcnh7 UTSW 2 62845774 missense probably benign 0.06
R6614:Kcnh7 UTSW 2 62777596 missense probably damaging 1.00
R6753:Kcnh7 UTSW 2 62850377 missense probably benign
R6822:Kcnh7 UTSW 2 62787904 missense probably damaging 1.00
R6863:Kcnh7 UTSW 2 62787685 missense possibly damaging 0.83
R7104:Kcnh7 UTSW 2 62787687 missense possibly damaging 0.82
R7116:Kcnh7 UTSW 2 62877270 missense probably benign 0.02
R7263:Kcnh7 UTSW 2 62735970 splice site probably null
R7657:Kcnh7 UTSW 2 62736035 missense probably damaging 1.00
R7855:Kcnh7 UTSW 2 62837194 nonsense probably null
R7968:Kcnh7 UTSW 2 62736100 missense probably damaging 1.00
R8183:Kcnh7 UTSW 2 62702977 missense probably damaging 0.99
R8343:Kcnh7 UTSW 2 62850535 missense probably benign 0.01
R8405:Kcnh7 UTSW 2 62703102 missense probably benign 0.04
R8411:Kcnh7 UTSW 2 62764608 missense probably damaging 1.00
R8493:Kcnh7 UTSW 2 62850659 missense probably benign 0.31
R8744:Kcnh7 UTSW 2 63182089 missense possibly damaging 0.93
X0011:Kcnh7 UTSW 2 62764723 missense probably damaging 0.99
Z1088:Kcnh7 UTSW 2 62736103 missense probably damaging 1.00
Z1088:Kcnh7 UTSW 2 63184068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGGCAGGATCACTTACCAC -3'
(R):5'- GTGTGCTTCAAAATTACATGACTTC -3'

Sequencing Primer
(F):5'- GGCAGGATCACTTACCACTTCTTC -3'
(R):5'- CTTTGGGAGCAGATGTCT -3'
Posted On2021-02-01