Incidental Mutation 'G1citation:Grik5'
ID660724
Institutional Source Beutler Lab
Gene Symbol Grik5
Ensembl Gene ENSMUSG00000003378
Gene Nameglutamate receptor, ionotropic, kainate 5 (gamma 2)
SynonymsGluRgamma2, KA2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #G1citation (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location25009849-25072346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25046355 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 431 (R431Q)
Ref Sequence ENSEMBL: ENSMUSP00000003468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003468] [ENSMUST00000205328] [ENSMUST00000206134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003468
AA Change: R431Q

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003468
Gene: ENSMUSG00000003378
AA Change: R431Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 40 381 3.4e-64 PFAM
PBPe 416 785 3.7e-122 SMART
Lig_chan-Glu_bd 426 490 1.65e-29 SMART
transmembrane domain 804 823 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 893 921 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205328
Predicted Effect probably benign
Transcript: ENSMUST00000206134
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele display abnormal hippocampal synapse function. Mice homozygous for a second allele display decreased thermal nociception, increased startle response and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 G A 11: 102,776,675 R687Q possibly damaging Het
AI987944 A G 7: 41,374,808 L249P probably damaging Het
Ankrd28 T A 14: 31,736,840 probably null Het
Bahcc1 T C 11: 120,287,721 S2369P probably damaging Het
Birc6 T C 17: 74,580,382 S902P possibly damaging Het
Birc6 A T 17: 74,598,044 K1277N probably damaging Het
Brwd1 T C 16: 96,041,274 E821G probably benign Het
Cct8l1 T C 5: 25,517,939 S551P possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cyp2c39 A T 19: 39,536,817 D188V probably damaging Het
Dclk3 G T 9: 111,439,337 A25S probably benign Het
Dpep2 A T 8: 105,985,241 M518K probably benign Het
Dst T C 1: 34,275,674 V6462A probably damaging Het
Entpd3 T C 9: 120,562,038 probably null Het
Epm2aip1 T C 9: 111,272,556 V199A probably damaging Het
Fam193b A G 13: 55,541,691 probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fcgbp T A 7: 28,107,356 Y2250N probably damaging Het
H2-Aa C T 17: 34,287,677 probably null Het
Igsf9 T A 1: 172,497,163 S883T possibly damaging Het
Kcnh7 T G 2: 62,787,904 I414L probably damaging Het
Kcnma1 T C 14: 24,003,744 probably null Het
Kcnmb1 T C 11: 33,964,686 probably benign Het
Kmt2d A G 15: 98,849,459 probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Nlgn1 T C 3: 26,133,647 T30A probably benign Het
Nucb1 A G 7: 45,498,865 F175L probably damaging Het
Pax6 T A 2: 105,685,923 V182E probably benign Het
Ptger1 A G 8: 83,668,650 D252G probably benign Het
Rexo4 T C 2: 26,960,271 D275G probably damaging Het
Ripk4 T C 16: 97,746,036 D342G probably damaging Het
Rpl10l A T 12: 66,284,213 C49S possibly damaging Het
Sema7a T C 9: 57,960,336 F457S probably damaging Het
Shank3 G A 15: 89,531,627 D155N probably damaging Het
Smpd3 G A 8: 106,265,964 probably benign Het
Smpd4 T C 16: 17,640,233 V465A probably damaging Het
Sohlh2 T C 3: 55,207,686 V364A probably damaging Het
Sos2 C T 12: 69,650,649 R99Q probably damaging Het
Spry2 G A 14: 105,893,357 Q132* probably null Het
Tbx19 G T 1: 165,140,140 P346Q probably damaging Het
Tdrd6 A G 17: 43,627,215 Y981H probably damaging Het
Tinag T C 9: 77,031,702 K165E probably benign Het
Tubb4a A T 17: 57,080,904 I374N probably damaging Het
Umodl1 C T 17: 30,986,554 Q708* probably null Het
Vmn2r3 A T 3: 64,287,455 V14E probably benign Het
Zfp82 G A 7: 30,056,287 L457F probably damaging Het
Other mutations in Grik5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Grik5 APN 7 25065393 missense probably damaging 1.00
IGL00974:Grik5 APN 7 25013885 missense probably damaging 1.00
IGL01941:Grik5 APN 7 25065182 missense probably damaging 1.00
IGL02642:Grik5 APN 7 25058983 missense possibly damaging 0.51
IGL03177:Grik5 APN 7 25015454 missense probably damaging 1.00
IGL03402:Grik5 APN 7 25015469 missense probably damaging 1.00
Griffin UTSW 7 25059077 missense possibly damaging 0.78
PIT4453001:Grik5 UTSW 7 25010694 missense probably damaging 0.99
R0077:Grik5 UTSW 7 25023380 missense probably damaging 1.00
R0412:Grik5 UTSW 7 25013674 missense possibly damaging 0.59
R0427:Grik5 UTSW 7 25058498 missense probably benign 0.34
R1191:Grik5 UTSW 7 25058325 nonsense probably null
R1830:Grik5 UTSW 7 25046301 missense possibly damaging 0.94
R2072:Grik5 UTSW 7 25015313 missense possibly damaging 0.92
R2369:Grik5 UTSW 7 25058537 missense probably damaging 1.00
R3410:Grik5 UTSW 7 25062972 missense probably benign 0.04
R3411:Grik5 UTSW 7 25062972 missense probably benign 0.04
R3615:Grik5 UTSW 7 25022571 missense probably benign 0.37
R3616:Grik5 UTSW 7 25022571 missense probably benign 0.37
R4600:Grik5 UTSW 7 25068064 missense probably damaging 0.99
R4658:Grik5 UTSW 7 25060727 splice site probably benign
R4735:Grik5 UTSW 7 25058288 missense probably damaging 1.00
R4810:Grik5 UTSW 7 25015497 missense probably damaging 0.98
R5113:Grik5 UTSW 7 25015527 missense probably damaging 1.00
R5120:Grik5 UTSW 7 25010640 missense probably damaging 1.00
R5132:Grik5 UTSW 7 25065204 missense probably benign 0.02
R5173:Grik5 UTSW 7 25062894 missense possibly damaging 0.76
R5186:Grik5 UTSW 7 25015819 missense probably damaging 1.00
R5239:Grik5 UTSW 7 25065470 missense probably damaging 1.00
R5935:Grik5 UTSW 7 25059077 missense possibly damaging 0.78
R6335:Grik5 UTSW 7 25013594 missense probably benign
R6609:Grik5 UTSW 7 25015526 nonsense probably null
R6760:Grik5 UTSW 7 25058939 critical splice donor site probably null
R6820:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6821:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6822:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6824:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R7173:Grik5 UTSW 7 25068162 missense probably damaging 1.00
R7230:Grik5 UTSW 7 25023070 missense probably damaging 1.00
R7555:Grik5 UTSW 7 25060597 missense probably benign
R7560:Grik5 UTSW 7 25058526 missense probably damaging 0.99
R7571:Grik5 UTSW 7 25013885 missense possibly damaging 0.87
R8228:Grik5 UTSW 7 25010508 missense probably damaging 1.00
R8228:Grik5 UTSW 7 25046310 missense possibly damaging 0.93
R8681:Grik5 UTSW 7 25010472 missense probably benign 0.06
R8879:Grik5 UTSW 7 25023064 missense possibly damaging 0.95
R8933:Grik5 UTSW 7 25023318 missense probably benign 0.11
X0017:Grik5 UTSW 7 25060588 missense probably damaging 1.00
Z1176:Grik5 UTSW 7 25013804 missense probably damaging 0.98
Z1177:Grik5 UTSW 7 25015825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAGTTCTCCAACCATGCCT -3'
(R):5'- TAAAGGAGTATGTGCACCCG -3'

Sequencing Primer
(F):5'- TGTCCAGGAACCGTTGGG -3'
(R):5'- CTCAGCAGTTCAGAGCATTGG -3'
Posted On2021-02-01