Incidental Mutation 'G1citation:Smpd3'
ID660733
Institutional Source Beutler Lab
Gene Symbol Smpd3
Ensembl Gene ENSMUSG00000031906
Gene Namesphingomyelin phosphodiesterase 3, neutral
Synonymsneutral sphingomyelinase II, nSMase2, fro, 4631433G07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #G1citation (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location106252548-106337988 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 106265964 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067512] [ENSMUST00000212896]
Predicted Effect probably benign
Transcript: ENSMUST00000067512
SMART Domains Protein: ENSMUSP00000069255
Gene: ENSMUSG00000031906

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Pfam:Exo_endo_phos 321 639 1.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212896
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 94% (46/49)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit dwarfism, delayed sexual and gonad maturation, delayed ossification of the long bones, and reduced serum levels of thyroxine, triiodothyronine, cortisol, and insulin-like growth factor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 G A 11: 102,776,675 R687Q possibly damaging Het
AI987944 A G 7: 41,374,808 L249P probably damaging Het
Ankrd28 T A 14: 31,736,840 probably null Het
Bahcc1 T C 11: 120,287,721 S2369P probably damaging Het
Birc6 T C 17: 74,580,382 S902P possibly damaging Het
Birc6 A T 17: 74,598,044 K1277N probably damaging Het
Brwd1 T C 16: 96,041,274 E821G probably benign Het
Cct8l1 T C 5: 25,517,939 S551P possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cyp2c39 A T 19: 39,536,817 D188V probably damaging Het
Dclk3 G T 9: 111,439,337 A25S probably benign Het
Dpep2 A T 8: 105,985,241 M518K probably benign Het
Dst T C 1: 34,275,674 V6462A probably damaging Het
Entpd3 T C 9: 120,562,038 probably null Het
Epm2aip1 T C 9: 111,272,556 V199A probably damaging Het
Fam193b A G 13: 55,541,691 probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fcgbp T A 7: 28,107,356 Y2250N probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
H2-Aa C T 17: 34,287,677 probably null Het
Igsf9 T A 1: 172,497,163 S883T possibly damaging Het
Kcnh7 T G 2: 62,787,904 I414L probably damaging Het
Kcnma1 T C 14: 24,003,744 probably null Het
Kcnmb1 T C 11: 33,964,686 probably benign Het
Kmt2d A G 15: 98,849,459 probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Nlgn1 T C 3: 26,133,647 T30A probably benign Het
Nucb1 A G 7: 45,498,865 F175L probably damaging Het
Pax6 T A 2: 105,685,923 V182E probably benign Het
Ptger1 A G 8: 83,668,650 D252G probably benign Het
Rexo4 T C 2: 26,960,271 D275G probably damaging Het
Ripk4 T C 16: 97,746,036 D342G probably damaging Het
Rpl10l A T 12: 66,284,213 C49S possibly damaging Het
Sema7a T C 9: 57,960,336 F457S probably damaging Het
Shank3 G A 15: 89,531,627 D155N probably damaging Het
Smpd4 T C 16: 17,640,233 V465A probably damaging Het
Sohlh2 T C 3: 55,207,686 V364A probably damaging Het
Sos2 C T 12: 69,650,649 R99Q probably damaging Het
Spry2 G A 14: 105,893,357 Q132* probably null Het
Tbx19 G T 1: 165,140,140 P346Q probably damaging Het
Tdrd6 A G 17: 43,627,215 Y981H probably damaging Het
Tinag T C 9: 77,031,702 K165E probably benign Het
Tubb4a A T 17: 57,080,904 I374N probably damaging Het
Umodl1 C T 17: 30,986,554 Q708* probably null Het
Vmn2r3 A T 3: 64,287,455 V14E probably benign Het
Zfp82 G A 7: 30,056,287 L457F probably damaging Het
Other mutations in Smpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03380:Smpd3 APN 8 106259659 missense probably benign 0.01
BB010:Smpd3 UTSW 8 106255622 missense probably benign
BB020:Smpd3 UTSW 8 106255622 missense probably benign
R0240:Smpd3 UTSW 8 106265156 missense probably damaging 0.96
R0240:Smpd3 UTSW 8 106265156 missense probably damaging 0.96
R0456:Smpd3 UTSW 8 106259656 missense probably benign
R0759:Smpd3 UTSW 8 106265228 missense probably benign 0.34
R0799:Smpd3 UTSW 8 106264789 missense possibly damaging 0.92
R1544:Smpd3 UTSW 8 106265567 missense possibly damaging 0.70
R1756:Smpd3 UTSW 8 106264971 missense probably benign
R2937:Smpd3 UTSW 8 106264820 missense probably damaging 1.00
R2939:Smpd3 UTSW 8 106257407 missense probably benign 0.00
R4614:Smpd3 UTSW 8 106259739 missense probably damaging 1.00
R5829:Smpd3 UTSW 8 106264880 missense probably benign 0.15
R6822:Smpd3 UTSW 8 106265964 start gained probably benign
R6891:Smpd3 UTSW 8 106264668 missense probably damaging 1.00
R6962:Smpd3 UTSW 8 106265219 missense probably benign 0.34
R6965:Smpd3 UTSW 8 106259881 missense probably damaging 1.00
R7344:Smpd3 UTSW 8 106265193 missense probably damaging 1.00
R7394:Smpd3 UTSW 8 106265010 missense probably damaging 0.99
R7823:Smpd3 UTSW 8 106255622 missense probably benign
R7825:Smpd3 UTSW 8 106255622 missense probably benign
R7933:Smpd3 UTSW 8 106255622 missense probably benign
R7974:Smpd3 UTSW 8 106255622 missense probably benign
R7975:Smpd3 UTSW 8 106255622 missense probably benign
R7976:Smpd3 UTSW 8 106255622 missense probably benign
R7977:Smpd3 UTSW 8 106259894 missense probably benign 0.11
R7987:Smpd3 UTSW 8 106259894 missense probably benign 0.11
R8260:Smpd3 UTSW 8 106257415 missense probably benign 0.13
R8264:Smpd3 UTSW 8 106264658 missense probably damaging 1.00
R8292:Smpd3 UTSW 8 106264790 missense probably benign 0.08
R8432:Smpd3 UTSW 8 106257677 critical splice acceptor site probably null
R8494:Smpd3 UTSW 8 106255350 missense probably damaging 0.99
R8779:Smpd3 UTSW 8 106265489 missense probably benign 0.37
R8787:Smpd3 UTSW 8 106255745 missense probably damaging 1.00
Z1177:Smpd3 UTSW 8 106264842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGCGCTTCTCATAGGTG -3'
(R):5'- GGGTTTTGGAACAGCCTAATTC -3'

Sequencing Primer
(F):5'- CTCATAGGTGGTGGGTATGAAAG -3'
(R):5'- GCCTAATTCAGTAAAGGACTCCTTC -3'
Posted On2021-02-01