Incidental Mutation 'G1citation:Sema7a'
ID660734
Institutional Source Beutler Lab
Gene Symbol Sema7a
Ensembl Gene ENSMUSG00000038264
Gene Namesema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A
SynonymsCDw108, Semal, 2900057C09Rik, Semaphorin K1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #G1citation (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location57940112-57962865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57960336 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 457 (F457S)
Ref Sequence ENSEMBL: ENSMUSP00000042211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043059]
Predicted Effect probably damaging
Transcript: ENSMUST00000043059
AA Change: F457S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042211
Gene: ENSMUSG00000038264
AA Change: F457S

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Sema 72 472 4.11e-119 SMART
PSI 490 540 7.64e-9 SMART
IG 549 630 3.63e-1 SMART
transmembrane domain 644 663 N/A INTRINSIC
Meta Mutation Damage Score 0.8375 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 94% (46/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of proteins. The encoded preproprotein is proteolytically processed to generate the mature glycosylphosphatidylinositol (GPI)-anchored membrane glycoprotein. The encoded protein is found on activated lymphocytes and erythrocytes and may be involved in immunomodulatory and neuronal processes. The encoded protein carries the John Milton Hagen (JMH) blood group antigens. Mutations in this gene may be associated with reduced bone mineral density (BMD). Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: The development of the olfactory tract is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 G A 11: 102,776,675 R687Q possibly damaging Het
AI987944 A G 7: 41,374,808 L249P probably damaging Het
Ankrd28 T A 14: 31,736,840 probably null Het
Bahcc1 T C 11: 120,287,721 S2369P probably damaging Het
Birc6 T C 17: 74,580,382 S902P possibly damaging Het
Birc6 A T 17: 74,598,044 K1277N probably damaging Het
Brwd1 T C 16: 96,041,274 E821G probably benign Het
Cct8l1 T C 5: 25,517,939 S551P possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cyp2c39 A T 19: 39,536,817 D188V probably damaging Het
Dclk3 G T 9: 111,439,337 A25S probably benign Het
Dpep2 A T 8: 105,985,241 M518K probably benign Het
Dst T C 1: 34,275,674 V6462A probably damaging Het
Entpd3 T C 9: 120,562,038 probably null Het
Epm2aip1 T C 9: 111,272,556 V199A probably damaging Het
Fam193b A G 13: 55,541,691 probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fcgbp T A 7: 28,107,356 Y2250N probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
H2-Aa C T 17: 34,287,677 probably null Het
Igsf9 T A 1: 172,497,163 S883T possibly damaging Het
Kcnh7 T G 2: 62,787,904 I414L probably damaging Het
Kcnma1 T C 14: 24,003,744 probably null Het
Kcnmb1 T C 11: 33,964,686 probably benign Het
Kmt2d A G 15: 98,849,459 probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Nlgn1 T C 3: 26,133,647 T30A probably benign Het
Nucb1 A G 7: 45,498,865 F175L probably damaging Het
Pax6 T A 2: 105,685,923 V182E probably benign Het
Ptger1 A G 8: 83,668,650 D252G probably benign Het
Rexo4 T C 2: 26,960,271 D275G probably damaging Het
Ripk4 T C 16: 97,746,036 D342G probably damaging Het
Rpl10l A T 12: 66,284,213 C49S possibly damaging Het
Shank3 G A 15: 89,531,627 D155N probably damaging Het
Smpd3 G A 8: 106,265,964 probably benign Het
Smpd4 T C 16: 17,640,233 V465A probably damaging Het
Sohlh2 T C 3: 55,207,686 V364A probably damaging Het
Sos2 C T 12: 69,650,649 R99Q probably damaging Het
Spry2 G A 14: 105,893,357 Q132* probably null Het
Tbx19 G T 1: 165,140,140 P346Q probably damaging Het
Tdrd6 A G 17: 43,627,215 Y981H probably damaging Het
Tinag T C 9: 77,031,702 K165E probably benign Het
Tubb4a A T 17: 57,080,904 I374N probably damaging Het
Umodl1 C T 17: 30,986,554 Q708* probably null Het
Vmn2r3 A T 3: 64,287,455 V14E probably benign Het
Zfp82 G A 7: 30,056,287 L457F probably damaging Het
Other mutations in Sema7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Sema7a APN 9 57955838 missense probably damaging 1.00
IGL01967:Sema7a APN 9 57956395 missense probably damaging 1.00
IGL02030:Sema7a APN 9 57955140 missense possibly damaging 0.91
IGL02031:Sema7a APN 9 57955140 missense possibly damaging 0.91
IGL02115:Sema7a APN 9 57960900 missense probably damaging 1.00
IGL02203:Sema7a APN 9 57957606 missense probably benign
IGL02808:Sema7a APN 9 57960348 missense probably benign 0.25
R0531:Sema7a UTSW 9 57960593 missense possibly damaging 0.95
R1603:Sema7a UTSW 9 57960676 missense probably benign 0.18
R1845:Sema7a UTSW 9 57954899 missense possibly damaging 0.65
R4598:Sema7a UTSW 9 57953551 missense probably benign 0.04
R4903:Sema7a UTSW 9 57955095 missense probably benign 0.00
R4954:Sema7a UTSW 9 57956380 missense probably damaging 1.00
R5172:Sema7a UTSW 9 57957678 missense probably benign 0.02
R5514:Sema7a UTSW 9 57955763 missense probably damaging 1.00
R5618:Sema7a UTSW 9 57960283 missense possibly damaging 0.71
R5652:Sema7a UTSW 9 57960659 missense probably damaging 1.00
R5793:Sema7a UTSW 9 57960257 missense probably damaging 0.98
R6365:Sema7a UTSW 9 57954905 missense probably benign 0.31
R6736:Sema7a UTSW 9 57960571 missense probably damaging 1.00
R6822:Sema7a UTSW 9 57960336 missense probably damaging 1.00
R6829:Sema7a UTSW 9 57960898 missense probably benign 0.00
R7380:Sema7a UTSW 9 57961564 missense unknown
R7381:Sema7a UTSW 9 57953569 missense probably benign 0.00
R7467:Sema7a UTSW 9 57961422 missense probably damaging 1.00
R7593:Sema7a UTSW 9 57960575 missense probably benign 0.06
R7601:Sema7a UTSW 9 57940277 missense probably benign 0.14
R7879:Sema7a UTSW 9 57955080 missense probably damaging 1.00
R8360:Sema7a UTSW 9 57955691 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGTGACACTCGAATGAGC -3'
(R):5'- TGAGTCCTCAAGCTTTGAAGAAGG -3'

Sequencing Primer
(F):5'- TGTGACACTCGAATGAGCCATAAC -3'
(R):5'- GTCCTCAAGCTTTGAAGAAGGAACTC -3'
Posted On2021-02-01