Incidental Mutation 'G1citation:Umodl1'
ID 660755
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # G1citation (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 30954679-31010708 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 30986554 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 708 (Q708*)
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect probably null
Transcript: ENSMUST00000066554
AA Change: Q708*
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: Q708*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066981
AA Change: Q679*
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: Q679*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
AA Change: Q708*
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: Q708*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 94% (46/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 G A 11: 102,776,675 R687Q possibly damaging Het
AI987944 A G 7: 41,374,808 L249P probably damaging Het
Ankrd28 T A 14: 31,736,840 probably null Het
Bahcc1 T C 11: 120,287,721 S2369P probably damaging Het
Birc6 T C 17: 74,580,382 S902P possibly damaging Het
Birc6 A T 17: 74,598,044 K1277N probably damaging Het
Brwd1 T C 16: 96,041,274 E821G probably benign Het
Cct8l1 T C 5: 25,517,939 S551P possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cyp2c39 A T 19: 39,536,817 D188V probably damaging Het
Dclk3 G T 9: 111,439,337 A25S probably benign Het
Dpep2 A T 8: 105,985,241 M518K probably benign Het
Dst T C 1: 34,275,674 V6462A probably damaging Het
Entpd3 T C 9: 120,562,038 probably null Het
Epm2aip1 T C 9: 111,272,556 V199A probably damaging Het
Fam193b A G 13: 55,541,691 probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fcgbp T A 7: 28,107,356 Y2250N probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
H2-Aa C T 17: 34,287,677 probably null Het
Igsf9 T A 1: 172,497,163 S883T possibly damaging Het
Kcnh7 T G 2: 62,787,904 I414L probably damaging Het
Kcnma1 T C 14: 24,003,744 probably null Het
Kcnmb1 T C 11: 33,964,686 probably benign Het
Kmt2d A G 15: 98,849,459 probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Nlgn1 T C 3: 26,133,647 T30A probably benign Het
Nucb1 A G 7: 45,498,865 F175L probably damaging Het
Pax6 T A 2: 105,685,923 V182E probably benign Het
Ptger1 A G 8: 83,668,650 D252G probably benign Het
Rexo4 T C 2: 26,960,271 D275G probably damaging Het
Ripk4 T C 16: 97,746,036 D342G probably damaging Het
Rpl10l A T 12: 66,284,213 C49S possibly damaging Het
Sema7a T C 9: 57,960,336 F457S probably damaging Het
Shank3 G A 15: 89,531,627 D155N probably damaging Het
Smpd3 G A 8: 106,265,964 probably benign Het
Smpd4 T C 16: 17,640,233 V465A probably damaging Het
Sohlh2 T C 3: 55,207,686 V364A probably damaging Het
Sos2 C T 12: 69,650,649 R99Q probably damaging Het
Spry2 G A 14: 105,893,357 Q132* probably null Het
Tbx19 G T 1: 165,140,140 P346Q probably damaging Het
Tdrd6 A G 17: 43,627,215 Y981H probably damaging Het
Tinag T C 9: 77,031,702 K165E probably benign Het
Tubb4a A T 17: 57,080,904 I374N probably damaging Het
Vmn2r3 A T 3: 64,287,455 V14E probably benign Het
Zfp82 G A 7: 30,056,287 L457F probably damaging Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
Disquieting UTSW 17 30959155 missense probably damaging 1.00
floored UTSW 17 30988057 nonsense probably null
R7231_umodl1_507 UTSW 17 30986116 missense probably damaging 1.00
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 30986387 missense probably benign 0.00
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
R8826:Umodl1 UTSW 17 30983984 missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 30973703 missense probably damaging 1.00
R9091:Umodl1 UTSW 17 30966704 missense probably damaging 1.00
R9099:Umodl1 UTSW 17 30959173 missense probably benign 0.01
R9270:Umodl1 UTSW 17 30966704 missense probably damaging 1.00
R9341:Umodl1 UTSW 17 30998727 missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 30998727 missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 30996393 missense probably damaging 0.99
R9569:Umodl1 UTSW 17 30998169 missense probably damaging 1.00
R9615:Umodl1 UTSW 17 30998178 missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 30959350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGTGACAAGCTCTGTTC -3'
(R):5'- GTCTGAGCCCACCTATGTTCAAG -3'

Sequencing Primer
(F):5'- GTGACAAGCTCTGTTCCCTGG -3'
(R):5'- TGAGCCCACCTATGTTCAAGATGAG -3'
Posted On 2021-02-01