Incidental Mutation 'R8353:C130073F10Rik'
ID 660775
Institutional Source Beutler Lab
Gene Symbol C130073F10Rik
Ensembl Gene ENSMUSG00000046133
Gene Name RIKEN cDNA C130073F10 gene
Synonyms
MMRRC Submission 067805-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R8353 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 101747217-101750986 bp(-) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to T at 101747881 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051043] [ENSMUST00000051043]
AlphaFold Q8C4L8
Predicted Effect probably null
Transcript: ENSMUST00000051043
Predicted Effect probably null
Transcript: ENSMUST00000051043
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,310,659 (GRCm39) T752A probably damaging Het
Adar A G 3: 89,657,569 (GRCm39) T508A possibly damaging Het
Atxn3 T A 12: 101,912,159 (GRCm39) K85I probably benign Het
Atxn7l1 G T 12: 33,197,882 (GRCm39) W50L probably damaging Het
Bahcc1 T C 11: 120,165,251 (GRCm39) V894A probably damaging Het
Bloc1s3 G T 7: 19,241,324 (GRCm39) T68K probably benign Het
Bmerb1 T A 16: 13,855,877 (GRCm39) probably null Het
Brd10 T C 19: 29,731,242 (GRCm39) H590R possibly damaging Het
Cd55b T C 1: 130,341,870 (GRCm39) I256V probably benign Het
Celsr3 T A 9: 108,703,734 (GRCm39) D72E probably benign Het
Cep41 T C 6: 30,658,891 (GRCm39) D152G probably benign Het
Cip2a C T 16: 48,821,436 (GRCm39) Q181* probably null Het
Cpne8 C A 15: 90,425,496 (GRCm39) K285N possibly damaging Het
Csmd3 A T 15: 47,813,349 (GRCm39) I1061K probably damaging Het
Cspg4 A T 9: 56,805,953 (GRCm39) N2255Y probably damaging Het
Cym T A 3: 107,129,025 (GRCm39) probably benign Het
Cyp2d9 T C 15: 82,336,720 (GRCm39) V23A probably damaging Het
Dnah1 A T 14: 31,005,159 (GRCm39) I2365K probably benign Het
Dock5 C T 14: 68,054,957 (GRCm39) probably null Het
Dop1a A T 9: 86,403,639 (GRCm39) H1613L probably damaging Het
Dusp5 T C 19: 53,518,113 (GRCm39) V122A possibly damaging Het
Emc6 A G 11: 73,067,399 (GRCm39) L44P probably damaging Het
Fbxl6 G T 15: 76,422,678 (GRCm39) T80K probably benign Het
Frrs1 T A 3: 116,692,822 (GRCm39) M32K possibly damaging Het
Gfod1 A G 13: 43,354,366 (GRCm39) V203A possibly damaging Het
Gjc2 G A 11: 59,067,840 (GRCm39) A214V unknown Het
Gkn2 T C 6: 87,355,135 (GRCm39) Y115H probably damaging Het
Gpatch1 A C 7: 34,976,704 (GRCm39) probably benign Het
Hemgn G T 4: 46,403,935 (GRCm39) P20Q possibly damaging Het
Herc1 G T 9: 66,415,571 (GRCm39) V4849L possibly damaging Het
Hmcn2 A T 2: 31,275,353 (GRCm39) probably null Het
Htt C A 5: 35,034,499 (GRCm39) T1990N possibly damaging Het
Jrk C T 15: 74,578,474 (GRCm39) W270* probably null Het
Katnb1 A G 8: 95,822,072 (GRCm39) D266G probably damaging Het
Klhl42 A G 6: 147,009,421 (GRCm39) K420R probably damaging Het
Lamb1 C A 12: 31,356,998 (GRCm39) T1035K probably damaging Het
Laptm5 T C 4: 130,656,079 (GRCm39) probably null Het
Lilra5 T C 7: 4,240,971 (GRCm39) S22P probably benign Het
Mn1 A G 5: 111,568,505 (GRCm39) N825S possibly damaging Het
Mup17 C T 4: 61,510,419 (GRCm39) probably null Het
Ncapd3 T A 9: 26,983,100 (GRCm39) D949E probably benign Het
Ncoa7 T C 10: 30,570,155 (GRCm39) E230G probably damaging Het
Nxnl1 A G 8: 72,015,512 (GRCm39) V132A probably damaging Het
Oard1 A G 17: 48,723,788 (GRCm39) I145V probably benign Het
Pabpc4 T G 4: 123,189,846 (GRCm39) L555R probably benign Het
Ppp1r11 G T 17: 37,260,866 (GRCm39) S21R possibly damaging Het
Prr36 T C 8: 4,263,831 (GRCm39) probably benign Het
Serpina1a T A 12: 103,822,038 (GRCm39) D298V probably benign Het
Sqle A T 15: 59,196,314 (GRCm39) H369L possibly damaging Het
Stambp T C 6: 83,538,881 (GRCm39) E173G probably damaging Het
Syne1 T C 10: 5,300,983 (GRCm39) N915S probably damaging Het
Tjap1 C A 17: 46,593,530 (GRCm39) probably benign Het
Tmem62 A C 2: 120,814,817 (GRCm39) K30T probably damaging Het
Tmtc1 T C 6: 148,327,346 (GRCm39) T56A probably benign Het
Trav6-4 A T 14: 53,691,946 (GRCm39) M18L probably benign Het
Trim69 T C 2: 121,998,490 (GRCm39) I154T possibly damaging Het
Uggt1 T C 1: 36,209,377 (GRCm39) probably null Het
Usp48 T A 4: 137,350,693 (GRCm39) M60K probably benign Het
Usp7 A G 16: 8,513,735 (GRCm39) S753P probably benign Het
Vmn2r27 A C 6: 124,169,404 (GRCm39) N575K probably damaging Het
Wdfy4 A C 14: 32,695,581 (GRCm39) D2672E probably benign Het
Zdhhc17 G A 10: 110,845,803 (GRCm39) P30L probably benign Het
Zmym4 T A 4: 126,800,905 (GRCm39) Y565F possibly damaging Het
Other mutations in C130073F10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02805:C130073F10Rik APN 4 101,748,171 (GRCm39) start codon destroyed probably null 1.00
IGL02869:C130073F10Rik APN 4 101,747,590 (GRCm39) nonsense probably null
R0621:C130073F10Rik UTSW 4 101,747,992 (GRCm39) missense probably damaging 1.00
R1368:C130073F10Rik UTSW 4 101,747,953 (GRCm39) missense possibly damaging 0.78
R1471:C130073F10Rik UTSW 4 101,747,535 (GRCm39) missense probably benign 0.01
R4732:C130073F10Rik UTSW 4 101,747,907 (GRCm39) missense probably benign 0.03
R4733:C130073F10Rik UTSW 4 101,747,907 (GRCm39) missense probably benign 0.03
R5372:C130073F10Rik UTSW 4 101,747,684 (GRCm39) missense probably damaging 1.00
R5777:C130073F10Rik UTSW 4 101,747,946 (GRCm39) missense possibly damaging 0.49
R6510:C130073F10Rik UTSW 4 101,747,482 (GRCm39) missense probably benign 0.01
R6888:C130073F10Rik UTSW 4 101,747,453 (GRCm39) missense probably benign 0.12
R7229:C130073F10Rik UTSW 4 101,747,439 (GRCm39) missense probably benign 0.00
R8186:C130073F10Rik UTSW 4 101,748,031 (GRCm39) nonsense probably null
R8857:C130073F10Rik UTSW 4 101,747,555 (GRCm39) missense possibly damaging 0.52
R9559:C130073F10Rik UTSW 4 101,747,946 (GRCm39) missense possibly damaging 0.49
R9590:C130073F10Rik UTSW 4 101,747,618 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TGTGCAGAGATGATCCTGTCC -3'
(R):5'- AAGGAGGCCTTCACTAAGAGAC -3'

Sequencing Primer
(F):5'- AAGTCATGGTTGGCATCCAGC -3'
(R):5'- CGACATAAACTTGTGAAGCACCTGG -3'
Posted On 2021-02-24