Mutagenetix > Incidental Mutation

Incidental Mutation 'R8353:Dock5'

660778

Institutional Source

Beutler Lab

Gene Symbol

Dock5

Ensembl Gene

ENSMUSG00000044447

Gene Name

dedicator of cytokinesis 5

Synonyms

lr2, 1110060D06Rik, rlc

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.234) question?

Stock #

R8353 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67752135-67933442 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 67817508 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000036674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039135]

AlphaFold

B2RY04

Predicted Effect

probably null
Transcript: ENSMUST00000039135

SMART Domains

Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447

Domain	Start	End	E-Value	Type
SH3	11	68	1.45e-13	SMART
Pfam:DOCK_N	71	434	9e-110	PFAM
Pfam:DOCK-C2	439	636	1.1e-57	PFAM
low complexity region	752	764	N/A	INTRINSIC
Pfam:DHR-2	1133	1635	6.4e-99	PFAM
low complexity region	1663	1692	N/A	INTRINSIC
low complexity region	1815	1824	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900011O08Rik	T	A	16: 14,038,013		probably null	Het
9930021J03Rik	T	C	19: 29,753,842	H590R	possibly damaging	Het
Abr	T	C	11: 76,419,833	T752A	probably damaging	Het
Adar	A	G	3: 89,750,262	T508A	possibly damaging	Het
Atxn3	T	A	12: 101,945,900	K85I	probably benign	Het
Atxn7l1	G	T	12: 33,147,883	W50L	probably damaging	Het
Bahcc1	T	C	11: 120,274,425	V894A	probably damaging	Het
Bloc1s3	G	T	7: 19,507,399	T68K	probably benign	Het
C130073F10Rik	C	T	4: 101,890,684		probably null	Het
C330027C09Rik	C	T	16: 49,001,073	Q181*	probably null	Het
Cd55b	T	C	1: 130,414,133	I256V	probably benign	Het
Celsr3	T	A	9: 108,826,535	D72E	probably benign	Het
Cep41	T	C	6: 30,658,892	D152G	probably benign	Het
Cpne8	C	A	15: 90,541,293	K285N	possibly damaging	Het
Csmd3	A	T	15: 47,949,953	I1061K	probably damaging	Het
Cspg4	A	T	9: 56,898,669	N2255Y	probably damaging	Het
Cym	T	A	3: 107,221,709		probably benign	Het
Cyp2d9	T	C	15: 82,452,519	V23A	probably damaging	Het
Dnah1	A	T	14: 31,283,202	I2365K	probably benign	Het
Dopey1	A	T	9: 86,521,586	H1613L	probably damaging	Het
Dusp5	T	C	19: 53,529,682	V122A	possibly damaging	Het
Emc6	A	G	11: 73,176,573	L44P	probably damaging	Het
Fbxl6	G	T	15: 76,538,478	T80K	probably benign	Het
Frrs1	T	A	3: 116,899,173	M32K	possibly damaging	Het
Gfod1	A	G	13: 43,200,890	V203A	possibly damaging	Het
Gjc2	G	A	11: 59,177,014	A214V	unknown	Het
Gkn2	T	C	6: 87,378,153	Y115H	probably damaging	Het
Gpatch1	A	C	7: 35,277,279		probably benign	Het
Hemgn	G	T	4: 46,403,935	P20Q	possibly damaging	Het
Herc1	G	T	9: 66,508,289	V4849L	possibly damaging	Het
Hmcn2	A	T	2: 31,385,341		probably null	Het
Htt	C	A	5: 34,877,155	T1990N	possibly damaging	Het
Jrk	C	T	15: 74,706,625	W270*	probably null	Het
Katnb1	A	G	8: 95,095,444	D266G	probably damaging	Het
Klhl42	A	G	6: 147,107,923	K420R	probably damaging	Het
Lamb1	C	A	12: 31,306,999	T1035K	probably damaging	Het
Laptm5	T	C	4: 130,928,768		probably null	Het
Lilra5	T	C	7: 4,237,972	S22P	probably benign	Het
Mn1	A	G	5: 111,420,639	N825S	possibly damaging	Het
Mup17	C	T	4: 61,592,182		probably null	Het
Ncapd3	T	A	9: 27,071,804	D949E	probably benign	Het
Ncoa7	T	C	10: 30,694,159	E230G	probably damaging	Het
Nxnl1	A	G	8: 71,562,868	V132A	probably damaging	Het
Oard1	A	G	17: 48,416,760	I145V	probably benign	Het
Pabpc4	T	G	4: 123,296,053	L555R	probably benign	Het
Ppp1r11	G	T	17: 36,949,974	S21R	possibly damaging	Het
Prr36	T	C	8: 4,213,831		probably benign	Het
Serpina1a	T	A	12: 103,855,779	D298V	probably benign	Het
Sqle	A	T	15: 59,324,465	H369L	possibly damaging	Het
Stambp	T	C	6: 83,561,899	E173G	probably damaging	Het
Syne1	T	C	10: 5,350,983	N915S	probably damaging	Het
Tjap1	C	A	17: 46,282,604		probably benign	Het
Tmem62	A	C	2: 120,984,336	K30T	probably damaging	Het
Tmtc1	T	C	6: 148,425,848	T56A	probably benign	Het
Trav6-4	A	T	14: 53,454,489	M18L	probably benign	Het
Trim69	T	C	2: 122,168,009	I154T	possibly damaging	Het
Uggt1	T	C	1: 36,170,296		probably null	Het
Usp48	T	A	4: 137,623,382	M60K	probably benign	Het
Usp7	A	G	16: 8,695,871	S753P	probably benign	Het
Vmn2r27	A	C	6: 124,192,445	N575K	probably damaging	Het
Wdfy4	A	C	14: 32,973,624	D2672E	probably benign	Het
Zdhhc17	G	A	10: 111,009,942	P30L	probably benign	Het
Zmym4	T	A	4: 126,907,112	Y565F	possibly damaging	Het

Other mutations in Dock5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Dock5	APN	14	67786889	splice site	probably benign
IGL00930:Dock5	APN	14	67771077	missense	probably damaging	1.00
IGL01525:Dock5	APN	14	67805720	splice site	probably benign
IGL01759:Dock5	APN	14	67881259	nonsense	probably null
IGL01941:Dock5	APN	14	67812232	missense	probably damaging	1.00
IGL02025:Dock5	APN	14	67763287	missense	probably damaging	1.00
IGL02093:Dock5	APN	14	67839543	splice site	probably benign
IGL02179:Dock5	APN	14	67806496	splice site	probably benign
IGL02208:Dock5	APN	14	67828450	missense	probably benign	0.06
IGL02605:Dock5	APN	14	67828438	missense	probably benign	0.18
IGL02608:Dock5	APN	14	67828439	missense	probably benign	0.01
IGL02938:Dock5	APN	14	67757218	splice site	probably benign
IGL02971:Dock5	APN	14	67757109	missense	probably null	1.00
IGL02983:Dock5	APN	14	67764670	missense	probably damaging	1.00
IGL03151:Dock5	APN	14	67866067	missense	probably damaging	1.00
IGL03410:Dock5	APN	14	67846086	missense	probably benign	0.04
PIT4366001:Dock5	UTSW	14	67824674	missense	possibly damaging	0.83
R0026:Dock5	UTSW	14	67846081	missense	probably benign	0.00
R0058:Dock5	UTSW	14	67781036	missense	probably benign	0.00
R0058:Dock5	UTSW	14	67781036	missense	probably benign	0.00
R0112:Dock5	UTSW	14	67819641	missense	probably benign
R0127:Dock5	UTSW	14	67846042	missense	probably benign	0.13
R0144:Dock5	UTSW	14	67786286	missense	probably benign	0.18
R0312:Dock5	UTSW	14	67795991	missense	possibly damaging	0.82
R0360:Dock5	UTSW	14	67822680	splice site	probably benign
R0364:Dock5	UTSW	14	67822680	splice site	probably benign
R0496:Dock5	UTSW	14	67817518	missense	probably damaging	1.00
R0506:Dock5	UTSW	14	67784792	splice site	probably benign
R0586:Dock5	UTSW	14	67809032	missense	probably damaging	1.00
R0597:Dock5	UTSW	14	67784934	splice site	probably null
R0625:Dock5	UTSW	14	67841163	missense	probably benign
R1109:Dock5	UTSW	14	67806478	missense	possibly damaging	0.80
R1221:Dock5	UTSW	14	67759161	missense	probably benign	0.00
R1278:Dock5	UTSW	14	67839566	missense	possibly damaging	0.80
R1927:Dock5	UTSW	14	67846062	missense	possibly damaging	0.60
R1944:Dock5	UTSW	14	67757135	nonsense	probably null
R1946:Dock5	UTSW	14	67786316	missense	probably damaging	1.00
R2046:Dock5	UTSW	14	67812142	missense	probably benign
R2101:Dock5	UTSW	14	67794010	missense	probably benign	0.02
R2252:Dock5	UTSW	14	67784812	missense	probably damaging	0.98
R2882:Dock5	UTSW	14	67839620	missense	probably damaging	0.99
R3110:Dock5	UTSW	14	67857922	missense	possibly damaging	0.72
R3112:Dock5	UTSW	14	67857922	missense	possibly damaging	0.72
R4236:Dock5	UTSW	14	67756492	missense	probably benign	0.02
R4242:Dock5	UTSW	14	67828490	missense	probably benign	0.19
R4244:Dock5	UTSW	14	67774582	missense	probably benign	0.41
R4646:Dock5	UTSW	14	67842779	missense	probably benign	0.01
R4793:Dock5	UTSW	14	67800354	missense	probably benign	0.26
R4841:Dock5	UTSW	14	67817563	missense	probably damaging	0.98
R4842:Dock5	UTSW	14	67817563	missense	probably damaging	0.98
R5159:Dock5	UTSW	14	67792289	missense	probably benign	0.04
R5164:Dock5	UTSW	14	67817661	nonsense	probably null
R5206:Dock5	UTSW	14	67763184	missense	probably benign	0.35
R5207:Dock5	UTSW	14	67776284	missense	probably benign	0.06
R5322:Dock5	UTSW	14	67770266	missense	probably benign	0.41
R5374:Dock5	UTSW	14	67805756	missense	possibly damaging	0.81
R5413:Dock5	UTSW	14	67764655	missense	probably damaging	1.00
R5476:Dock5	UTSW	14	67814007	missense	possibly damaging	0.92
R5504:Dock5	UTSW	14	67803086	missense	probably benign	0.01
R5677:Dock5	UTSW	14	67777603	missense	probably benign	0.00
R5773:Dock5	UTSW	14	67796058	missense	possibly damaging	0.95
R5845:Dock5	UTSW	14	67841101	missense	possibly damaging	0.82
R5957:Dock5	UTSW	14	67857994	missense	probably benign
R6154:Dock5	UTSW	14	67859912	missense	probably benign	0.03
R6268:Dock5	UTSW	14	67790275	nonsense	probably null
R6393:Dock5	UTSW	14	67822602	missense	probably benign	0.32
R6512:Dock5	UTSW	14	67824648	missense	possibly damaging	0.93
R6759:Dock5	UTSW	14	67795996	missense	probably benign	0.00
R7012:Dock5	UTSW	14	67822586	missense	probably damaging	1.00
R7061:Dock5	UTSW	14	67770254	missense	probably damaging	0.96
R7196:Dock5	UTSW	14	67756470	missense	probably damaging	1.00
R7200:Dock5	UTSW	14	67771702	nonsense	probably null
R7311:Dock5	UTSW	14	67828502	missense	probably benign	0.25
R7359:Dock5	UTSW	14	67765888	missense	probably benign	0.10
R7422:Dock5	UTSW	14	67809030	missense	probably benign	0.01
R7588:Dock5	UTSW	14	67763158	critical splice donor site	probably null
R7637:Dock5	UTSW	14	67786340	missense	possibly damaging	0.95
R7709:Dock5	UTSW	14	67796005	missense	probably benign	0.44
R7763:Dock5	UTSW	14	67821327	missense	probably damaging	0.97
R8044:Dock5	UTSW	14	67824692	missense	probably damaging	1.00
R8076:Dock5	UTSW	14	67802977	splice site	probably null
R8168:Dock5	UTSW	14	67770197	splice site	probably null
R8480:Dock5	UTSW	14	67836410	missense	probably benign	0.32
R8535:Dock5	UTSW	14	67793976	missense	probably benign	0.19
R8708:Dock5	UTSW	14	67767371	missense	probably benign	0.02
R8732:Dock5	UTSW	14	67846000	missense	possibly damaging	0.85
R8888:Dock5	UTSW	14	67817663	missense	possibly damaging	0.95
R8895:Dock5	UTSW	14	67817663	missense	possibly damaging	0.95
R8936:Dock5	UTSW	14	67845990	nonsense	probably null
R8962:Dock5	UTSW	14	67757191	missense	probably benign
R8972:Dock5	UTSW	14	67776300	missense	probably damaging	1.00
R9244:Dock5	UTSW	14	67759114	missense	probably damaging	0.99
R9345:Dock5	UTSW	14	67822622	missense	possibly damaging	0.74
R9679:Dock5	UTSW	14	67781001	missense	probably damaging	1.00
X0023:Dock5	UTSW	14	67771088	missense	probably benign	0.15
Z1177:Dock5	UTSW	14	67813933	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CCTACTCGTGAATATGCCTAGG -3'
(R):5'- CCTGAGAGATATTGCCCTGATTC -3'

Sequencing Primer
(F):5'- AACCTCTGGGTCTACATGTCTATGAG -3'
(R):5'- AGATATTGCCCTGATTCTAGGTTTTC -3'

Posted On

2021-02-24