Incidental Mutation 'R8353:Dock5'
ID 660778
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms 1110060D06Rik, rlc, lr2
MMRRC Submission 067805-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.346) question?
Stock # R8353 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 67989584-68170891 bp(-) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) C to T at 68054957 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably null
Transcript: ENSMUST00000039135
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,310,659 (GRCm39) T752A probably damaging Het
Adar A G 3: 89,657,569 (GRCm39) T508A possibly damaging Het
Atxn3 T A 12: 101,912,159 (GRCm39) K85I probably benign Het
Atxn7l1 G T 12: 33,197,882 (GRCm39) W50L probably damaging Het
Bahcc1 T C 11: 120,165,251 (GRCm39) V894A probably damaging Het
Bloc1s3 G T 7: 19,241,324 (GRCm39) T68K probably benign Het
Bmerb1 T A 16: 13,855,877 (GRCm39) probably null Het
Brd10 T C 19: 29,731,242 (GRCm39) H590R possibly damaging Het
C130073F10Rik C T 4: 101,747,881 (GRCm39) probably null Het
Cd55b T C 1: 130,341,870 (GRCm39) I256V probably benign Het
Celsr3 T A 9: 108,703,734 (GRCm39) D72E probably benign Het
Cep41 T C 6: 30,658,891 (GRCm39) D152G probably benign Het
Cip2a C T 16: 48,821,436 (GRCm39) Q181* probably null Het
Cpne8 C A 15: 90,425,496 (GRCm39) K285N possibly damaging Het
Csmd3 A T 15: 47,813,349 (GRCm39) I1061K probably damaging Het
Cspg4 A T 9: 56,805,953 (GRCm39) N2255Y probably damaging Het
Cym T A 3: 107,129,025 (GRCm39) probably benign Het
Cyp2d9 T C 15: 82,336,720 (GRCm39) V23A probably damaging Het
Dnah1 A T 14: 31,005,159 (GRCm39) I2365K probably benign Het
Dop1a A T 9: 86,403,639 (GRCm39) H1613L probably damaging Het
Dusp5 T C 19: 53,518,113 (GRCm39) V122A possibly damaging Het
Emc6 A G 11: 73,067,399 (GRCm39) L44P probably damaging Het
Fbxl6 G T 15: 76,422,678 (GRCm39) T80K probably benign Het
Frrs1 T A 3: 116,692,822 (GRCm39) M32K possibly damaging Het
Gfod1 A G 13: 43,354,366 (GRCm39) V203A possibly damaging Het
Gjc2 G A 11: 59,067,840 (GRCm39) A214V unknown Het
Gkn2 T C 6: 87,355,135 (GRCm39) Y115H probably damaging Het
Gpatch1 A C 7: 34,976,704 (GRCm39) probably benign Het
Hemgn G T 4: 46,403,935 (GRCm39) P20Q possibly damaging Het
Herc1 G T 9: 66,415,571 (GRCm39) V4849L possibly damaging Het
Hmcn2 A T 2: 31,275,353 (GRCm39) probably null Het
Htt C A 5: 35,034,499 (GRCm39) T1990N possibly damaging Het
Jrk C T 15: 74,578,474 (GRCm39) W270* probably null Het
Katnb1 A G 8: 95,822,072 (GRCm39) D266G probably damaging Het
Klhl42 A G 6: 147,009,421 (GRCm39) K420R probably damaging Het
Lamb1 C A 12: 31,356,998 (GRCm39) T1035K probably damaging Het
Laptm5 T C 4: 130,656,079 (GRCm39) probably null Het
Lilra5 T C 7: 4,240,971 (GRCm39) S22P probably benign Het
Mn1 A G 5: 111,568,505 (GRCm39) N825S possibly damaging Het
Mup17 C T 4: 61,510,419 (GRCm39) probably null Het
Ncapd3 T A 9: 26,983,100 (GRCm39) D949E probably benign Het
Ncoa7 T C 10: 30,570,155 (GRCm39) E230G probably damaging Het
Nxnl1 A G 8: 72,015,512 (GRCm39) V132A probably damaging Het
Oard1 A G 17: 48,723,788 (GRCm39) I145V probably benign Het
Pabpc4 T G 4: 123,189,846 (GRCm39) L555R probably benign Het
Ppp1r11 G T 17: 37,260,866 (GRCm39) S21R possibly damaging Het
Prr36 T C 8: 4,263,831 (GRCm39) probably benign Het
Serpina1a T A 12: 103,822,038 (GRCm39) D298V probably benign Het
Sqle A T 15: 59,196,314 (GRCm39) H369L possibly damaging Het
Stambp T C 6: 83,538,881 (GRCm39) E173G probably damaging Het
Syne1 T C 10: 5,300,983 (GRCm39) N915S probably damaging Het
Tjap1 C A 17: 46,593,530 (GRCm39) probably benign Het
Tmem62 A C 2: 120,814,817 (GRCm39) K30T probably damaging Het
Tmtc1 T C 6: 148,327,346 (GRCm39) T56A probably benign Het
Trav6-4 A T 14: 53,691,946 (GRCm39) M18L probably benign Het
Trim69 T C 2: 121,998,490 (GRCm39) I154T possibly damaging Het
Uggt1 T C 1: 36,209,377 (GRCm39) probably null Het
Usp48 T A 4: 137,350,693 (GRCm39) M60K probably benign Het
Usp7 A G 16: 8,513,735 (GRCm39) S753P probably benign Het
Vmn2r27 A C 6: 124,169,404 (GRCm39) N575K probably damaging Het
Wdfy4 A C 14: 32,695,581 (GRCm39) D2672E probably benign Het
Zdhhc17 G A 10: 110,845,803 (GRCm39) P30L probably benign Het
Zmym4 T A 4: 126,800,905 (GRCm39) Y565F possibly damaging Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 68,024,338 (GRCm39) splice site probably benign
IGL00930:Dock5 APN 14 68,008,526 (GRCm39) missense probably damaging 1.00
IGL01525:Dock5 APN 14 68,043,169 (GRCm39) splice site probably benign
IGL01759:Dock5 APN 14 68,118,708 (GRCm39) nonsense probably null
IGL01941:Dock5 APN 14 68,049,681 (GRCm39) missense probably damaging 1.00
IGL02025:Dock5 APN 14 68,000,736 (GRCm39) missense probably damaging 1.00
IGL02093:Dock5 APN 14 68,076,992 (GRCm39) splice site probably benign
IGL02179:Dock5 APN 14 68,043,945 (GRCm39) splice site probably benign
IGL02208:Dock5 APN 14 68,065,899 (GRCm39) missense probably benign 0.06
IGL02605:Dock5 APN 14 68,065,887 (GRCm39) missense probably benign 0.18
IGL02608:Dock5 APN 14 68,065,888 (GRCm39) missense probably benign 0.01
IGL02938:Dock5 APN 14 67,994,667 (GRCm39) splice site probably benign
IGL02971:Dock5 APN 14 67,994,558 (GRCm39) missense probably null 1.00
IGL02983:Dock5 APN 14 68,002,119 (GRCm39) missense probably damaging 1.00
IGL03151:Dock5 APN 14 68,103,516 (GRCm39) missense probably damaging 1.00
IGL03410:Dock5 APN 14 68,083,535 (GRCm39) missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 68,062,123 (GRCm39) missense possibly damaging 0.83
R0026:Dock5 UTSW 14 68,083,530 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0058:Dock5 UTSW 14 68,018,485 (GRCm39) missense probably benign 0.00
R0112:Dock5 UTSW 14 68,057,090 (GRCm39) missense probably benign
R0127:Dock5 UTSW 14 68,083,491 (GRCm39) missense probably benign 0.13
R0144:Dock5 UTSW 14 68,023,735 (GRCm39) missense probably benign 0.18
R0312:Dock5 UTSW 14 68,033,440 (GRCm39) missense possibly damaging 0.82
R0360:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0364:Dock5 UTSW 14 68,060,129 (GRCm39) splice site probably benign
R0496:Dock5 UTSW 14 68,054,967 (GRCm39) missense probably damaging 1.00
R0506:Dock5 UTSW 14 68,022,241 (GRCm39) splice site probably benign
R0586:Dock5 UTSW 14 68,046,481 (GRCm39) missense probably damaging 1.00
R0597:Dock5 UTSW 14 68,022,383 (GRCm39) splice site probably null
R0625:Dock5 UTSW 14 68,078,612 (GRCm39) missense probably benign
R1109:Dock5 UTSW 14 68,043,927 (GRCm39) missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67,996,610 (GRCm39) missense probably benign 0.00
R1278:Dock5 UTSW 14 68,077,015 (GRCm39) missense possibly damaging 0.80
R1927:Dock5 UTSW 14 68,083,511 (GRCm39) missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67,994,584 (GRCm39) nonsense probably null
R1946:Dock5 UTSW 14 68,023,765 (GRCm39) missense probably damaging 1.00
R2046:Dock5 UTSW 14 68,049,591 (GRCm39) missense probably benign
R2101:Dock5 UTSW 14 68,031,459 (GRCm39) missense probably benign 0.02
R2252:Dock5 UTSW 14 68,022,261 (GRCm39) missense probably damaging 0.98
R2882:Dock5 UTSW 14 68,077,069 (GRCm39) missense probably damaging 0.99
R3110:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R3112:Dock5 UTSW 14 68,095,371 (GRCm39) missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67,993,941 (GRCm39) missense probably benign 0.02
R4242:Dock5 UTSW 14 68,065,939 (GRCm39) missense probably benign 0.19
R4244:Dock5 UTSW 14 68,012,031 (GRCm39) missense probably benign 0.41
R4646:Dock5 UTSW 14 68,080,228 (GRCm39) missense probably benign 0.01
R4793:Dock5 UTSW 14 68,037,803 (GRCm39) missense probably benign 0.26
R4841:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R4842:Dock5 UTSW 14 68,055,012 (GRCm39) missense probably damaging 0.98
R5159:Dock5 UTSW 14 68,029,738 (GRCm39) missense probably benign 0.04
R5164:Dock5 UTSW 14 68,055,110 (GRCm39) nonsense probably null
R5206:Dock5 UTSW 14 68,000,633 (GRCm39) missense probably benign 0.35
R5207:Dock5 UTSW 14 68,013,733 (GRCm39) missense probably benign 0.06
R5322:Dock5 UTSW 14 68,007,715 (GRCm39) missense probably benign 0.41
R5374:Dock5 UTSW 14 68,043,205 (GRCm39) missense possibly damaging 0.81
R5413:Dock5 UTSW 14 68,002,104 (GRCm39) missense probably damaging 1.00
R5476:Dock5 UTSW 14 68,051,456 (GRCm39) missense possibly damaging 0.92
R5504:Dock5 UTSW 14 68,040,535 (GRCm39) missense probably benign 0.01
R5677:Dock5 UTSW 14 68,015,052 (GRCm39) missense probably benign 0.00
R5773:Dock5 UTSW 14 68,033,507 (GRCm39) missense possibly damaging 0.95
R5845:Dock5 UTSW 14 68,078,550 (GRCm39) missense possibly damaging 0.82
R5957:Dock5 UTSW 14 68,095,443 (GRCm39) missense probably benign
R6154:Dock5 UTSW 14 68,097,361 (GRCm39) missense probably benign 0.03
R6268:Dock5 UTSW 14 68,027,724 (GRCm39) nonsense probably null
R6393:Dock5 UTSW 14 68,060,051 (GRCm39) missense probably benign 0.32
R6512:Dock5 UTSW 14 68,062,097 (GRCm39) missense possibly damaging 0.93
R6759:Dock5 UTSW 14 68,033,445 (GRCm39) missense probably benign 0.00
R7012:Dock5 UTSW 14 68,060,035 (GRCm39) missense probably damaging 1.00
R7061:Dock5 UTSW 14 68,007,703 (GRCm39) missense probably damaging 0.96
R7196:Dock5 UTSW 14 67,993,919 (GRCm39) missense probably damaging 1.00
R7200:Dock5 UTSW 14 68,009,151 (GRCm39) nonsense probably null
R7311:Dock5 UTSW 14 68,065,951 (GRCm39) missense probably benign 0.25
R7359:Dock5 UTSW 14 68,003,337 (GRCm39) missense probably benign 0.10
R7422:Dock5 UTSW 14 68,046,479 (GRCm39) missense probably benign 0.01
R7588:Dock5 UTSW 14 68,000,607 (GRCm39) critical splice donor site probably null
R7637:Dock5 UTSW 14 68,023,789 (GRCm39) missense possibly damaging 0.95
R7709:Dock5 UTSW 14 68,033,454 (GRCm39) missense probably benign 0.44
R7763:Dock5 UTSW 14 68,058,776 (GRCm39) missense probably damaging 0.97
R8044:Dock5 UTSW 14 68,062,141 (GRCm39) missense probably damaging 1.00
R8076:Dock5 UTSW 14 68,040,426 (GRCm39) splice site probably null
R8168:Dock5 UTSW 14 68,007,646 (GRCm39) splice site probably null
R8480:Dock5 UTSW 14 68,073,859 (GRCm39) missense probably benign 0.32
R8535:Dock5 UTSW 14 68,031,425 (GRCm39) missense probably benign 0.19
R8708:Dock5 UTSW 14 68,004,820 (GRCm39) missense probably benign 0.02
R8732:Dock5 UTSW 14 68,083,449 (GRCm39) missense possibly damaging 0.85
R8888:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8895:Dock5 UTSW 14 68,055,112 (GRCm39) missense possibly damaging 0.95
R8936:Dock5 UTSW 14 68,083,439 (GRCm39) nonsense probably null
R8962:Dock5 UTSW 14 67,994,640 (GRCm39) missense probably benign
R8972:Dock5 UTSW 14 68,013,749 (GRCm39) missense probably damaging 1.00
R9244:Dock5 UTSW 14 67,996,563 (GRCm39) missense probably damaging 0.99
R9345:Dock5 UTSW 14 68,060,071 (GRCm39) missense possibly damaging 0.74
R9679:Dock5 UTSW 14 68,018,450 (GRCm39) missense probably damaging 1.00
X0023:Dock5 UTSW 14 68,008,537 (GRCm39) missense probably benign 0.15
Z1177:Dock5 UTSW 14 68,051,382 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCTACTCGTGAATATGCCTAGG -3'
(R):5'- CCTGAGAGATATTGCCCTGATTC -3'

Sequencing Primer
(F):5'- AACCTCTGGGTCTACATGTCTATGAG -3'
(R):5'- AGATATTGCCCTGATTCTAGGTTTTC -3'
Posted On 2021-02-24