Incidental Mutation 'R8353:Dock5'
ID660778
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Namededicator of cytokinesis 5
Synonymslr2, 1110060D06Rik, rlc
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R8353 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location67752135-67933442 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 67817508 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
Predicted Effect probably null
Transcript: ENSMUST00000039135
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T A 16: 14,038,013 probably null Het
9930021J03Rik T C 19: 29,753,842 H590R possibly damaging Het
Abr T C 11: 76,419,833 T752A probably damaging Het
Adar A G 3: 89,750,262 T508A possibly damaging Het
Atxn3 T A 12: 101,945,900 K85I probably benign Het
Atxn7l1 G T 12: 33,147,883 W50L probably damaging Het
Bahcc1 T C 11: 120,274,425 V894A probably damaging Het
Bloc1s3 G T 7: 19,507,399 T68K probably benign Het
C130073F10Rik C T 4: 101,890,684 probably null Het
C330027C09Rik C T 16: 49,001,073 Q181* probably null Het
Cd55b T C 1: 130,414,133 I256V probably benign Het
Celsr3 T A 9: 108,826,535 D72E probably benign Het
Cep41 T C 6: 30,658,892 D152G probably benign Het
Cpne8 C A 15: 90,541,293 K285N possibly damaging Het
Csmd3 A T 15: 47,949,953 I1061K probably damaging Het
Cspg4 A T 9: 56,898,669 N2255Y probably damaging Het
Cym T A 3: 107,221,709 probably benign Het
Cyp2d9 T C 15: 82,452,519 V23A probably damaging Het
Dnah1 A T 14: 31,283,202 I2365K probably benign Het
Dopey1 A T 9: 86,521,586 H1613L probably damaging Het
Dusp5 T C 19: 53,529,682 V122A possibly damaging Het
Emc6 A G 11: 73,176,573 L44P probably damaging Het
Fbxl6 G T 15: 76,538,478 T80K probably benign Het
Frrs1 T A 3: 116,899,173 M32K possibly damaging Het
Gfod1 A G 13: 43,200,890 V203A possibly damaging Het
Gjc2 G A 11: 59,177,014 A214V unknown Het
Gkn2 T C 6: 87,378,153 Y115H probably damaging Het
Gpatch1 A C 7: 35,277,279 probably benign Het
Hemgn G T 4: 46,403,935 P20Q possibly damaging Het
Herc1 G T 9: 66,508,289 V4849L possibly damaging Het
Hmcn2 A T 2: 31,385,341 probably null Het
Htt C A 5: 34,877,155 T1990N possibly damaging Het
Jrk C T 15: 74,706,625 W270* probably null Het
Katnb1 A G 8: 95,095,444 D266G probably damaging Het
Klhl42 A G 6: 147,107,923 K420R probably damaging Het
Lamb1 C A 12: 31,306,999 T1035K probably damaging Het
Laptm5 T C 4: 130,928,768 probably null Het
Lilra5 T C 7: 4,237,972 S22P probably benign Het
Mn1 A G 5: 111,420,639 N825S possibly damaging Het
Mup17 C T 4: 61,592,182 probably null Het
Ncapd3 T A 9: 27,071,804 D949E probably benign Het
Ncoa7 T C 10: 30,694,159 E230G probably damaging Het
Nxnl1 A G 8: 71,562,868 V132A probably damaging Het
Oard1 A G 17: 48,416,760 I145V probably benign Het
Pabpc4 T G 4: 123,296,053 L555R probably benign Het
Ppp1r11 G T 17: 36,949,974 S21R possibly damaging Het
Prr36 T C 8: 4,213,831 probably benign Het
Serpina1a T A 12: 103,855,779 D298V probably benign Het
Sqle A T 15: 59,324,465 H369L possibly damaging Het
Stambp T C 6: 83,561,899 E173G probably damaging Het
Syne1 T C 10: 5,350,983 N915S probably damaging Het
Tjap1 C A 17: 46,282,604 probably benign Het
Tmem62 A C 2: 120,984,336 K30T probably damaging Het
Tmtc1 T C 6: 148,425,848 T56A probably benign Het
Trav6-4 A T 14: 53,454,489 M18L probably benign Het
Trim69 T C 2: 122,168,009 I154T possibly damaging Het
Uggt1 T C 1: 36,170,296 probably null Het
Usp48 T A 4: 137,623,382 M60K probably benign Het
Usp7 A G 16: 8,695,871 S753P probably benign Het
Vmn2r27 A C 6: 124,192,445 N575K probably damaging Het
Wdfy4 A C 14: 32,973,624 D2672E probably benign Het
Zdhhc17 G A 10: 111,009,942 P30L probably benign Het
Zmym4 T A 4: 126,907,112 Y565F possibly damaging Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCTACTCGTGAATATGCCTAGG -3'
(R):5'- CCTGAGAGATATTGCCCTGATTC -3'

Sequencing Primer
(F):5'- AACCTCTGGGTCTACATGTCTATGAG -3'
(R):5'- AGATATTGCCCTGATTCTAGGTTTTC -3'
Posted On2021-02-24