Incidental Mutation 'R8528:Gsdmc'
ID660781
Institutional Source Beutler Lab
Gene Symbol Gsdmc
Ensembl Gene ENSMUSG00000079025
Gene Namegasdermin C
SynonymsMlze, Gsdmc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8528 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location63775968-63808759 bp(-) (GRCm38)
Type of Mutationsplice site (101 bp from exon)
DNA Base Change (assembly) A to T at 63777340 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110125] [ENSMUST00000173503]
AlphaFold Q99NB5
Predicted Effect probably null
Transcript: ENSMUST00000110125
SMART Domains Protein: ENSMUSP00000105752
Gene: ENSMUSG00000079025

DomainStartEndE-ValueType
Pfam:Gasdermin 4 444 6.2e-170 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173503
SMART Domains Protein: ENSMUSP00000133683
Gene: ENSMUSG00000079025

DomainStartEndE-ValueType
Pfam:Gasdermin 4 435 9.6e-157 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,575,851 I169L possibly damaging Het
Ahnak A T 19: 9,007,728 K2125N probably damaging Het
Arl5b T A 2: 15,073,327 probably null Het
BC055324 T C 1: 163,986,083 K191E probably damaging Het
Ccng2 T C 5: 93,269,305 V60A possibly damaging Het
Cfap65 A G 1: 74,905,937 V1442A possibly damaging Het
Cyp1b1 T A 17: 79,710,564 E387D probably damaging Het
Dchs2 T C 3: 83,354,611 S2729P probably damaging Het
Dnah11 A G 12: 118,008,803 F2882S probably damaging Het
Dpy30 T C 17: 74,299,762 D97G probably benign Het
Enam T A 5: 88,502,219 V454E probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Ero1lb T A 13: 12,599,868 C240* probably null Het
Exog A G 9: 119,462,620 D297G probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fer1l5 A G 1: 36,417,774 Y1611C possibly damaging Het
Frmpd1 T C 4: 45,285,034 V1285A probably benign Het
Gfpt1 G C 6: 87,066,788 probably null Het
Gm15446 T C 5: 109,943,030 Y383H possibly damaging Het
Hao1 A G 2: 134,522,993 I238T probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kcnv2 T A 19: 27,322,987 D79E probably benign Het
Lrrc8a T C 2: 30,255,545 Y124H probably damaging Het
Lrrc8d T A 5: 105,812,486 M254K probably benign Het
Map3k4 T C 17: 12,232,934 N1489S probably damaging Het
Mapk8ip2 A G 15: 89,455,219 D34G probably damaging Het
Myo9a A G 9: 59,860,140 T876A probably damaging Het
Pabpc2 C T 18: 39,775,386 T568I probably benign Het
Pcdhga2 G T 18: 37,669,168 A22S probably benign Het
Rc3h2 G A 2: 37,382,799 T755I probably benign Het
Sertad4 A G 1: 192,851,083 V15A probably benign Het
Slc28a2 A G 2: 122,455,742 K520E probably damaging Het
Slc4a10 T C 2: 62,296,796 V831A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spag17 A T 3: 100,124,185 I2255F possibly damaging Het
Sprn C T 7: 140,153,510 probably benign Het
Stim1 T C 7: 102,431,082 probably benign Het
Stk24 C A 14: 121,292,035 A402S probably benign Het
Sycp2 A G 2: 178,374,533 L712P probably damaging Het
Tenm3 C T 8: 48,342,633 G269S probably damaging Het
Zdbf2 A G 1: 63,303,386 E308G possibly damaging Het
Zfp442 A C 2: 150,409,042 H312Q probably damaging Het
Other mutations in Gsdmc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Gsdmc APN 15 63804421 missense probably benign 0.41
IGL00791:Gsdmc APN 15 63804435 missense possibly damaging 0.85
IGL01889:Gsdmc APN 15 63780003 missense possibly damaging 0.89
IGL01917:Gsdmc APN 15 63778585 missense probably benign
IGL01948:Gsdmc APN 15 63778581 missense probably damaging 1.00
IGL02391:Gsdmc APN 15 63803579 missense probably damaging 0.99
IGL02479:Gsdmc APN 15 63777975 missense possibly damaging 0.87
IGL02551:Gsdmc APN 15 63801933 missense probably benign 0.00
R0115:Gsdmc UTSW 15 63803637 missense probably damaging 0.99
R1523:Gsdmc UTSW 15 63803630 missense probably damaging 0.99
R1655:Gsdmc UTSW 15 63780043 missense probably benign 0.42
R1990:Gsdmc UTSW 15 63801899 missense probably benign 0.12
R1991:Gsdmc UTSW 15 63801899 missense probably benign 0.12
R2267:Gsdmc UTSW 15 63776798 missense probably benign 0.12
R2882:Gsdmc UTSW 15 63779795 missense probably benign 0.24
R2943:Gsdmc UTSW 15 63803652 missense possibly damaging 0.91
R4110:Gsdmc UTSW 15 63780027 missense probably benign 0.08
R4712:Gsdmc UTSW 15 63779537 missense probably benign 0.01
R4963:Gsdmc UTSW 15 63804380 critical splice donor site probably null
R4997:Gsdmc UTSW 15 63776780 missense probably damaging 1.00
R5032:Gsdmc UTSW 15 63802033 missense possibly damaging 0.63
R5276:Gsdmc UTSW 15 63801957 missense probably benign 0.25
R5346:Gsdmc UTSW 15 63776886 missense probably damaging 1.00
R5963:Gsdmc UTSW 15 63780116 splice site probably null
R5965:Gsdmc UTSW 15 63804598 critical splice acceptor site probably null
R6872:Gsdmc UTSW 15 63778707 missense possibly damaging 0.79
R7035:Gsdmc UTSW 15 63778720 splice site probably null
R7408:Gsdmc UTSW 15 63804466 missense probably benign
R7719:Gsdmc UTSW 15 63778964 splice site probably null
R7862:Gsdmc UTSW 15 63777996 missense possibly damaging 0.52
R8697:Gsdmc UTSW 15 63780034 missense probably benign 0.12
R9069:Gsdmc UTSW 15 63778053 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGTGCACACATGTATGCATATG -3'
(R):5'- GTGATACCCAACTCTGTCTGC -3'

Sequencing Primer
(F):5'- GCACACATGTATGCATATGGCTATAC -3'
(R):5'- AACTCTGTCTGCTGGCCCTG -3'
Posted On2021-02-26