Incidental Mutation 'R8059:Rgs3'
ID660792
Institutional Source Beutler Lab
Gene Symbol Rgs3
Ensembl Gene ENSMUSG00000059810
Gene Nameregulator of G-protein signaling 3
SynonymsC2pa, PDZ-RGS3, RGS3S, C2PA-RGS3, 4930506N09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R8059 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location62559847-62704001 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 62602977 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065870] [ENSMUST00000098031]
Predicted Effect probably benign
Transcript: ENSMUST00000065870
SMART Domains Protein: ENSMUSP00000065447
Gene: ENSMUSG00000059810

DomainStartEndE-ValueType
C2 47 150 7.98e-15 SMART
PDZ 203 272 8.09e-10 SMART
low complexity region 465 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098031
SMART Domains Protein: ENSMUSP00000095639
Gene: ENSMUSG00000059810

DomainStartEndE-ValueType
C2 39 142 7.98e-15 SMART
PDZ 195 264 8.09e-10 SMART
low complexity region 457 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signaling (RGS) family. This protein is a GTPase-activating protein that inhibits G-protein-mediated signal transduction. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. Long isoforms are largely cytosolic and plasma membrane-associated with a function in Wnt signaling and in the epithelial mesenchymal transition, while shorter N-terminally-truncated isoforms can be nuclear. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired T cell migration in model of Th2-mediated airway inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,279 M3372K probably benign Het
Abcg3 A T 5: 104,953,082 probably null Het
Adam19 G A 11: 46,136,466 probably benign Het
Adgrg6 G T 10: 14,469,050 T53K probably damaging Het
Ccdc141 A C 2: 77,044,751 L705R probably damaging Het
Cep78 A T 19: 15,981,512 V156E probably benign Het
Cers2 A G 3: 95,322,671 D342G probably damaging Het
Chl1 T A 6: 103,674,987 I272N probably damaging Het
Defb30 A G 14: 63,035,934 *77Q probably null Het
Dnm3 A G 1: 162,084,139 V63A probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Entpd2 G T 2: 25,398,084 V107L probably damaging Het
Hectd1 T A 12: 51,790,378 H799L possibly damaging Het
Hira T C 16: 18,912,151 V200A probably damaging Het
Hspd1 T C 1: 55,081,724 K269E possibly damaging Het
Kcnj4 T C 15: 79,484,802 S326G probably benign Het
Kctd19 T G 8: 105,396,351 I144L probably benign Het
Lama4 T C 10: 38,966,061 I36T probably benign Het
Lrrn3 T C 12: 41,454,217 T34A probably benign Het
Maml3 A G 3: 51,856,689 S285P probably damaging Het
Man2b2 A G 5: 36,816,160 Y492H probably damaging Het
Mapk10 G T 5: 102,966,612 N303K probably damaging Het
Matn2 C T 15: 34,345,335 R163C probably damaging Het
Mtmr7 C T 8: 40,581,522 A253T probably damaging Het
Naca C T 10: 128,040,503 P468L unknown Het
Nckap1l T C 15: 103,493,287 S1084P possibly damaging Het
Nek11 T C 9: 105,162,974 *629W probably null Het
Nfkb1 C T 3: 135,593,852 A731T possibly damaging Het
Nop2 T C 6: 125,140,812 V442A probably damaging Het
Oaz2 C T 9: 65,689,143 P163L probably damaging Het
Olfr1056 A G 2: 86,355,962 V140A probably benign Het
Olfr214 C T 6: 116,556,473 T16I possibly damaging Het
Olfr480 T C 7: 108,066,016 T231A probably benign Het
Pabpc2 A T 18: 39,774,822 N380I probably benign Het
Pax3 T C 1: 78,103,366 D461G probably benign Het
Pds5b G T 5: 150,807,835 R1443L unknown Het
Per1 G A 11: 69,106,483 R828H probably damaging Het
Phlpp2 T A 8: 109,895,557 S144T probably benign Het
Plod1 A T 4: 147,928,484 I207N probably damaging Het
Psmc6 A T 14: 45,340,803 I208F probably damaging Het
Rev3l T C 10: 39,843,495 S2494P probably damaging Het
Rtraf T C 14: 19,822,563 probably benign Het
Slc17a6 T A 7: 51,645,044 N166K probably damaging Het
Slc18a2 A T 19: 59,284,140 T348S probably benign Het
Slc39a8 G T 3: 135,826,586 A39S probably benign Het
Slc8a3 C T 12: 81,202,258 G799S probably damaging Het
Sp1 T G 15: 102,407,902 S46R possibly damaging Het
Spta1 A G 1: 174,218,370 probably benign Het
Stab1 G A 14: 31,160,241 P499L probably benign Het
Tmem57 A T 4: 134,828,048 C371* probably null Het
Trav21-dv12 C A 14: 53,876,721 D99E probably damaging Het
Trpv6 T G 6: 41,624,586 I467L probably benign Het
Ttc41 A G 10: 86,712,978 Y12C probably benign Het
Vmn1r233 T C 17: 20,994,436 N84S probably benign Het
Vrtn T C 12: 84,649,916 F480S probably benign Het
Wdr63 C G 3: 146,046,673 R749S possibly damaging Het
Zc3h13 C G 14: 75,327,810 R788G unknown Het
Other mutations in Rgs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rgs3 APN 4 62701180 missense possibly damaging 0.87
IGL00918:Rgs3 APN 4 62701067 missense probably damaging 1.00
IGL01594:Rgs3 APN 4 62619744 missense probably damaging 0.99
IGL01761:Rgs3 APN 4 62652709 splice site probably benign
IGL02995:Rgs3 APN 4 62625847 missense possibly damaging 0.95
IGL03365:Rgs3 APN 4 62689675 missense probably benign
R0098:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0098:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0158:Rgs3 UTSW 4 62623884 missense probably damaging 1.00
R0609:Rgs3 UTSW 4 62625936 missense probably damaging 1.00
R0633:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0637:Rgs3 UTSW 4 62646673 splice site probably benign
R0893:Rgs3 UTSW 4 62605561 splice site probably null
R1612:Rgs3 UTSW 4 62625935 missense probably damaging 0.99
R1929:Rgs3 UTSW 4 62702147 missense probably damaging 1.00
R2202:Rgs3 UTSW 4 62690504 missense probably damaging 1.00
R2239:Rgs3 UTSW 4 62625887 missense probably benign 0.30
R2380:Rgs3 UTSW 4 62625887 missense probably benign 0.30
R2974:Rgs3 UTSW 4 62640720 missense probably damaging 1.00
R4871:Rgs3 UTSW 4 62631295 missense probably benign 0.01
R5229:Rgs3 UTSW 4 62702187 missense probably damaging 1.00
R5372:Rgs3 UTSW 4 62652697 intron probably benign
R5597:Rgs3 UTSW 4 62623845 missense probably damaging 1.00
R6006:Rgs3 UTSW 4 62623906 missense probably damaging 1.00
R6056:Rgs3 UTSW 4 62625906 missense probably damaging 0.96
R6732:Rgs3 UTSW 4 62602943 missense probably benign 0.00
R6962:Rgs3 UTSW 4 62700715 intron probably benign
R7141:Rgs3 UTSW 4 62690487 missense probably damaging 1.00
R7156:Rgs3 UTSW 4 62617126 missense probably damaging 0.99
R7193:Rgs3 UTSW 4 62615336 missense probably damaging 0.99
R7459:Rgs3 UTSW 4 62625154 missense probably benign 0.01
R7660:Rgs3 UTSW 4 62701112 missense possibly damaging 0.94
R7697:Rgs3 UTSW 4 62657142 missense probably benign 0.00
R8025:Rgs3 UTSW 4 62690594 missense probably damaging 0.97
R8242:Rgs3 UTSW 4 62619785 missense probably benign
R8413:Rgs3 UTSW 4 62626017 missense possibly damaging 0.54
R8489:Rgs3 UTSW 4 62626496 missense probably damaging 1.00
R8501:Rgs3 UTSW 4 62602956 missense possibly damaging 0.85
R8880:Rgs3 UTSW 4 62625136 missense probably damaging 1.00
Z1177:Rgs3 UTSW 4 62631214 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TTACTCCTTTGCCAGTGTGG -3'
(R):5'- TGACAGAGACTGGGTCTACAG -3'

Sequencing Primer
(F):5'- AACCAGGTGGCTTTGGAAGTC -3'
(R):5'- CTGGGTCTACAGAAAGCAGCTC -3'
Posted On2021-03-02