Incidental Mutation 'R8520:Dusp13'
ID 660797
Institutional Source Beutler Lab
Gene Symbol Dusp13
Ensembl Gene ENSMUSG00000021768
Gene Name dual specificity phosphatase 13
Synonyms TMDP, TS-DSP6, LMW-DSP6, LOC382853
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8520 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 21733394-21751181 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 21743470 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 208 (G208*)
Ref Sequence ENSEMBL: ENSMUSP00000120977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075040] [ENSMUST00000119866] [ENSMUST00000120956] [ENSMUST00000120984] [ENSMUST00000127851] [ENSMUST00000153071] [ENSMUST00000183698] [ENSMUST00000183893] [ENSMUST00000183943] [ENSMUST00000184571] [ENSMUST00000184703] [ENSMUST00000185042]
AlphaFold Q9QYJ7
Predicted Effect probably benign
Transcript: ENSMUST00000075040
SMART Domains Protein: ENSMUSP00000074553
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 37 181 7.66e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119866
SMART Domains Protein: ENSMUSP00000112552
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120956
SMART Domains Protein: ENSMUSP00000113305
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 110 255 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120984
SMART Domains Protein: ENSMUSP00000113985
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127851
AA Change: G208*
SMART Domains Protein: ENSMUSP00000120977
Gene: ENSMUSG00000021768
AA Change: G208*

DomainStartEndE-ValueType
SCOP:d1vhra_ 20 133 9e-10 SMART
Blast:DSPc 37 129 5e-60 BLAST
PDB:2E0T|A 39 129 1e-26 PDB
low complexity region 162 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153071
SMART Domains Protein: ENSMUSP00000139140
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
Pfam:DSPc 1 48 5.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183698
SMART Domains Protein: ENSMUSP00000139058
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 68 213 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183893
SMART Domains Protein: ENSMUSP00000139061
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183943
SMART Domains Protein: ENSMUSP00000139154
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
internal_repeat_1 19 71 6.78e-8 PROSPERO
DSPc 95 240 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184571
Predicted Effect probably benign
Transcript: ENSMUST00000184703
SMART Domains Protein: ENSMUSP00000138972
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185042
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In humans, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,609 F136L possibly damaging Het
A430033K04Rik T A 5: 138,646,706 N284K possibly damaging Het
Abcb1a T C 5: 8,685,346 I151T possibly damaging Het
Adam28 C T 14: 68,642,083 G172D probably damaging Het
Adcy6 A G 15: 98,604,160 V191A probably benign Het
Ankrd52 T C 10: 128,389,490 L911P probably damaging Het
C5ar1 A G 7: 16,248,151 S315P probably damaging Het
Cubn A G 2: 13,308,520 probably null Het
Dlec1 T C 9: 119,112,209 S276P probably benign Het
Dnah14 T A 1: 181,653,638 I1564N probably damaging Het
Dsg2 G A 18: 20,579,451 G171R probably damaging Het
Ebf3 A C 7: 137,201,124 probably null Het
Fbn2 A T 18: 58,038,198 probably null Het
Fbxo27 A G 7: 28,693,342 D16G probably benign Het
G6pc3 A G 11: 102,193,108 S187G probably benign Het
Gucy2d G A 7: 98,472,306 V995I probably null Het
Hmcn2 C A 2: 31,354,714 P728T probably damaging Het
Il1r2 T C 1: 40,105,339 L62P probably damaging Het
Ints7 T C 1: 191,582,491 S63P probably damaging Het
Mcf2l C A 8: 12,880,089 D36E probably benign Het
Mfsd13b T G 7: 120,991,363 I109S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Mydgf C A 17: 56,183,734 probably null Het
Nanog A T 6: 122,713,516 L268F possibly damaging Het
Olfr305 A T 7: 86,364,263 C25S probably benign Het
Olfr536 T A 7: 140,504,402 D19V probably benign Het
Otud4 T A 8: 79,659,267 N256K probably damaging Het
P2rx1 A T 11: 73,008,953 D128V probably benign Het
Pappa G A 4: 65,335,764 V1552I probably benign Het
Pax8 A T 2: 24,443,022 F103I probably damaging Het
Ptk2b T A 14: 66,174,755 S396C probably damaging Het
Rnf148 A G 6: 23,654,170 Y276H probably damaging Het
Sec11c A T 18: 65,814,840 I93L probably damaging Het
Serpinb2 T A 1: 107,523,180 N217K probably benign Het
Slc2a13 T A 15: 91,572,902 T66S probably damaging Het
Slc4a3 T C 1: 75,549,862 M9T probably benign Het
Sord G A 2: 122,256,942 V176I possibly damaging Het
Thbs4 G A 13: 92,754,284 Q892* probably null Het
Thsd7b T A 1: 129,921,420 D956E probably benign Het
Tmem251 T A 12: 102,744,172 probably null Het
Topbp1 T A 9: 103,308,977 probably null Het
Tst T C 15: 78,405,253 E194G probably damaging Het
Ttk T A 9: 83,857,327 S484T possibly damaging Het
U2surp A G 9: 95,502,554 S26P possibly damaging Het
Ugt2b37 C T 5: 87,240,855 A500T probably benign Het
Utrn A T 10: 12,670,186 Y1669* probably null Het
Vmn2r23 A T 6: 123,741,656 Q656L probably damaging Het
Wdr7 A G 18: 63,987,160 N1424S probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp984 T A 4: 147,756,211 Y61F probably benign Het
Other mutations in Dusp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Dusp13 APN 14 21733839 missense probably damaging 1.00
IGL02963:Dusp13 APN 14 21733807 missense possibly damaging 0.86
R0827:Dusp13 UTSW 14 21742771 missense probably benign
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1185:Dusp13 UTSW 14 21735018 missense probably damaging 1.00
R1882:Dusp13 UTSW 14 21734975 missense probably benign 0.04
R2915:Dusp13 UTSW 14 21740137 missense probably damaging 1.00
R3954:Dusp13 UTSW 14 21740107 missense probably damaging 1.00
R4623:Dusp13 UTSW 14 21743478 unclassified probably benign
R4837:Dusp13 UTSW 14 21743525 utr 3 prime probably benign
R6713:Dusp13 UTSW 14 21748473 missense probably damaging 1.00
R7294:Dusp13 UTSW 14 21733714 missense possibly damaging 0.47
R7782:Dusp13 UTSW 14 21741336 missense possibly damaging 0.86
R8088:Dusp13 UTSW 14 21741237 missense probably benign 0.33
R8176:Dusp13 UTSW 14 21747481 missense possibly damaging 0.81
R8227:Dusp13 UTSW 14 21742801 missense probably benign
R8724:Dusp13 UTSW 14 21746407 missense probably benign 0.04
R8973:Dusp13 UTSW 14 21734906 missense probably benign 0.01
R9031:Dusp13 UTSW 14 21740165 missense probably benign 0.00
R9142:Dusp13 UTSW 14 21742688 missense probably benign 0.30
R9186:Dusp13 UTSW 14 21748495 missense probably damaging 0.97
R9258:Dusp13 UTSW 14 21741087 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGTCTTCACGCTGAGTCCAC -3'
(R):5'- TTGCACAGCCTGGGTTTAAG -3'

Sequencing Primer
(F):5'- AAGCAGTTTGCCCAAGGTC -3'
(R):5'- CCTGGGTTTAAGGAGGAAGTACC -3'
Posted On 2021-03-02