Incidental Mutation 'R8440:Nedd4l'
ID660808
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 4-like
SynonymsNedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R8440 (G1)
Quality Score46.0072
Status Validated
Chromosome18
Chromosomal Location64887705-65217831 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to T at 64889055 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000224347] [ENSMUST00000224385] [ENSMUST00000225057] [ENSMUST00000225261]
Predicted Effect probably benign
Transcript: ENSMUST00000163516
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably null
Transcript: ENSMUST00000224347
Predicted Effect probably null
Transcript: ENSMUST00000224347
Predicted Effect probably benign
Transcript: ENSMUST00000224385
Predicted Effect probably benign
Transcript: ENSMUST00000225057
Predicted Effect probably benign
Transcript: ENSMUST00000225261
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G C 3: 152,504,043 probably null Het
Bbs9 T A 9: 22,567,750 V163E probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cbr3 T C 16: 93,683,533 I70T probably damaging Het
Chka T C 19: 3,893,375 Y426H probably damaging Het
Cpq T A 15: 33,213,195 M120K possibly damaging Het
Dcaf1 T A 9: 106,847,874 C520S possibly damaging Het
Egfr T C 11: 16,909,831 Y1018H probably damaging Het
Eif3l T C 15: 79,076,920 Y58H possibly damaging Het
Frmd8 T C 19: 5,865,174 Y234C possibly damaging Het
Fus T C 7: 127,969,826 Y50H unknown Het
Hmcn1 T A 1: 150,694,920 Q2164L probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hsd11b1 T C 1: 193,222,112 K260E probably benign Het
Igkv4-91 C T 6: 68,768,572 G114D probably benign Het
Inpp4b G A 8: 82,041,895 E678K probably damaging Het
Kifc3 G T 8: 95,109,794 P113Q possibly damaging Het
Lgi4 T A 7: 31,060,624 probably null Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Meiob G T 17: 24,818,328 C60F probably benign Het
Olfr1378 T C 11: 50,969,197 Y60H probably damaging Het
Olfr555 G A 7: 102,659,068 M82I probably damaging Het
Olfr76 C T 19: 12,119,944 C244Y probably damaging Het
Omp A G 7: 98,145,046 F125L probably damaging Het
Pcdha3 T C 18: 36,947,861 V552A probably damaging Het
Plek T C 11: 16,995,276 D18G possibly damaging Het
Ppip5k2 T C 1: 97,747,551 T376A probably damaging Het
Prkdc CAAA CAAAA 16: 15,835,158 probably null Het
Rabgap1 T C 2: 37,542,680 probably null Het
Rtn1 T A 12: 72,223,399 I113F probably damaging Het
Ssu2 T A 6: 112,387,989 D4V probably benign Het
St6galnac2 T C 11: 116,677,548 H363R probably damaging Het
Stk19 T C 17: 34,836,480 S60G possibly damaging Het
Suco G A 1: 161,852,338 T332I probably damaging Het
Trbv20 T A 6: 41,188,958 Y106N probably damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Vmn1r128 G A 7: 21,349,820 V150I probably benign Het
Vmn2r54 A T 7: 12,616,086 V523E possibly damaging Het
Vmn2r61 A T 7: 42,266,656 E231V probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp592 G C 7: 81,041,523 S1150T possibly damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65195185 splice site probably benign
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65212820 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4435:Nedd4l UTSW 18 65212825 missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65203880 missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65165605 missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65080060 nonsense probably null
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6465:Nedd4l UTSW 18 65155264 missense probably benign 0.06
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
R7193:Nedd4l UTSW 18 64997370 missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65080018 missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65186367 missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65074774 missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65209698 missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65191489 missense probably damaging 0.98
R8499:Nedd4l UTSW 18 65209657 missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65203915 missense probably benign 0.00
R8801:Nedd4l UTSW 18 65155275 missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65165617 missense not run
RF013:Nedd4l UTSW 18 65209680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCTAAATCACTGTTCAGC -3'
(R):5'- AAGCCATAACGTGAGCCTGTC -3'

Sequencing Primer
(F):5'- GTTCAGCCCTCACTCGACCAG -3'
(R):5'- GAGCCTGTCTCAGATAATAGACTCTC -3'
Posted On2021-03-03