Incidental Mutation 'R8440:Nedd4l'
ID 660808
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 067884-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R8440 (G1)
Quality Score 46.0072
Status Validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to T at 65022126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000224347] [ENSMUST00000224385] [ENSMUST00000225057] [ENSMUST00000225261]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000163516
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably null
Transcript: ENSMUST00000224347
Predicted Effect probably null
Transcript: ENSMUST00000224347
Predicted Effect probably benign
Transcript: ENSMUST00000224385
Predicted Effect probably benign
Transcript: ENSMUST00000225057
Predicted Effect probably benign
Transcript: ENSMUST00000225261
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G C 3: 152,209,680 (GRCm39) probably null Het
Bbs9 T A 9: 22,479,046 (GRCm39) V163E probably damaging Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Cbr3 T C 16: 93,480,421 (GRCm39) I70T probably damaging Het
Chka T C 19: 3,943,375 (GRCm39) Y426H probably damaging Het
Cpq T A 15: 33,213,341 (GRCm39) M120K possibly damaging Het
Dcaf1 T A 9: 106,725,073 (GRCm39) C520S possibly damaging Het
Egfr T C 11: 16,859,831 (GRCm39) Y1018H probably damaging Het
Eif3l T C 15: 78,961,120 (GRCm39) Y58H possibly damaging Het
Frmd8 T C 19: 5,915,202 (GRCm39) Y234C possibly damaging Het
Fus T C 7: 127,568,998 (GRCm39) Y50H unknown Het
Hmcn1 T A 1: 150,570,671 (GRCm39) Q2164L probably damaging Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Hsd11b1 T C 1: 192,904,420 (GRCm39) K260E probably benign Het
Igkv4-91 C T 6: 68,745,556 (GRCm39) G114D probably benign Het
Inpp4b G A 8: 82,768,524 (GRCm39) E678K probably damaging Het
Kifc3 G T 8: 95,836,422 (GRCm39) P113Q possibly damaging Het
Lgi4 T A 7: 30,760,049 (GRCm39) probably null Het
Map1s A G 8: 71,365,163 (GRCm39) N107D probably damaging Het
Meiob G T 17: 25,037,302 (GRCm39) C60F probably benign Het
Omp A G 7: 97,794,253 (GRCm39) F125L probably damaging Het
Or1ad6 T C 11: 50,860,024 (GRCm39) Y60H probably damaging Het
Or51h1 G A 7: 102,308,275 (GRCm39) M82I probably damaging Het
Or5a1 C T 19: 12,097,308 (GRCm39) C244Y probably damaging Het
Pcdha3 T C 18: 37,080,914 (GRCm39) V552A probably damaging Het
Plek T C 11: 16,945,276 (GRCm39) D18G possibly damaging Het
Ppip5k2 T C 1: 97,675,276 (GRCm39) T376A probably damaging Het
Prkdc CAAA CAAAA 16: 15,653,022 (GRCm39) 3833 probably null Het
Rabgap1 T C 2: 37,432,692 (GRCm39) probably null Het
Rtn1 T A 12: 72,270,173 (GRCm39) I113F probably damaging Het
Ssu2 T A 6: 112,364,950 (GRCm39) D4V probably benign Het
St6galnac2 T C 11: 116,568,374 (GRCm39) H363R probably damaging Het
Stk19 T C 17: 35,055,456 (GRCm39) S60G possibly damaging Het
Suco G A 1: 161,679,907 (GRCm39) T332I probably damaging Het
Trbv20 T A 6: 41,165,892 (GRCm39) Y106N probably damaging Het
Uck1 C A 2: 32,150,153 (GRCm39) probably benign Het
Vmn1r128 G A 7: 21,083,745 (GRCm39) V150I probably benign Het
Vmn2r54 A T 7: 12,350,013 (GRCm39) V523E possibly damaging Het
Vmn2r61 A T 7: 41,916,080 (GRCm39) E231V probably benign Het
Xkr9 A G 1: 13,771,603 (GRCm39) D373G probably benign Het
Zfp592 G C 7: 80,691,271 (GRCm39) S1150T possibly damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCTAAATCACTGTTCAGC -3'
(R):5'- AAGCCATAACGTGAGCCTGTC -3'

Sequencing Primer
(F):5'- GTTCAGCCCTCACTCGACCAG -3'
(R):5'- GAGCCTGTCTCAGATAATAGACTCTC -3'
Posted On 2021-03-03