Incidental Mutation 'R8526:Serpinb3a'
ID660809
Institutional Source Beutler Lab
Gene Symbol Serpinb3a
Ensembl Gene ENSMUSG00000044594
Gene Nameserine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3A
SynonymsSqn5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8526 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location107045587-107052303 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 107048774 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027567] [ENSMUST00000112717]
Predicted Effect probably null
Transcript: ENSMUST00000027567
SMART Domains Protein: ENSMUSP00000027567
Gene: ENSMUSG00000044594

DomainStartEndE-ValueType
SERPIN 13 387 6.36e-182 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112717
SMART Domains Protein: ENSMUSP00000108337
Gene: ENSMUSG00000044594

DomainStartEndE-ValueType
SERPIN 13 387 6.36e-182 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein is highly expressed in many tumor cells and can inactivate granzyme M, an enzyme that kills tumor cells. This protein, along with serpin B3, can be processed into smaller fragments that aggregate to form an autoantigen in psoriasis, probably by causing chronic inflammation. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to allergen-induced airway hyperresponsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,269,816 C706* probably null Het
4930522L14Rik T C 5: 109,737,789 I68V possibly damaging Het
4931422A03Rik G A 2: 104,026,154 R21C unknown Het
Actr5 T G 2: 158,632,304 F342L probably damaging Het
Adamts13 T C 2: 26,978,000 V124A probably benign Het
Amotl1 T C 9: 14,562,196 E606G probably damaging Het
Carmil2 C T 8: 105,688,815 A265V probably damaging Het
Cdh22 T C 2: 165,112,258 E781G probably damaging Het
Dennd1b G A 1: 139,023,120 W33* probably null Het
Dlc1 C T 8: 36,937,814 V274I probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Ect2l C T 10: 18,144,627 E582K probably benign Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Ift88 A T 14: 57,445,669 K40* probably null Het
Igkv4-72 A G 6: 69,227,156 V17A probably benign Het
Klhl28 T G 12: 64,951,626 T365P probably damaging Het
Krt16 T A 11: 100,246,483 Y434F probably benign Het
Lyst T A 13: 13,760,806 V3620E probably damaging Het
Mcm9 A T 10: 53,630,125 probably benign Het
Mef2a T C 7: 67,251,725 M100V possibly damaging Het
Mos T C 4: 3,871,709 K36E probably damaging Het
Ncapg2 T C 12: 116,440,059 Y864H probably benign Het
Olfr730 C T 14: 50,186,262 probably null Het
Olfr97 A G 17: 37,231,579 S264P probably damaging Het
Parp14 A T 16: 35,840,937 I1547N possibly damaging Het
Pcdh18 A T 3: 49,755,574 Y431N probably damaging Het
Phyhd1 T C 2: 30,266,943 probably null Het
Pkd2 T C 5: 104,489,236 F572L probably damaging Het
Rasgrf1 T A 9: 89,974,848 I453N probably damaging Het
Robo4 T A 9: 37,403,505 C218* probably null Het
Rrbp1 A G 2: 143,974,483 V742A probably benign Het
Sgsm2 T G 11: 74,869,021 E97A probably benign Het
Smad4 A T 18: 73,657,259 probably null Het
Snd1 T C 6: 28,745,254 Y533H probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stk36 A G 1: 74,634,544 T1199A probably benign Het
Veph1 T A 3: 66,159,316 N417I probably benign Het
Vmn1r8 A G 6: 57,036,377 S138G probably benign Het
Vmn2r10 C T 5: 108,997,706 V512I possibly damaging Het
Zfp740 A G 15: 102,208,291 D47G probably null Het
Zfp810 T C 9: 22,278,290 K441E probably damaging Het
Other mutations in Serpinb3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Serpinb3a APN 1 107051059 nonsense probably null
IGL01940:Serpinb3a APN 1 107046185 missense probably damaging 1.00
IGL02077:Serpinb3a APN 1 107046381 missense probably damaging 0.99
IGL02136:Serpinb3a APN 1 107046285 missense probably benign 0.15
IGL02214:Serpinb3a APN 1 107048488 critical splice donor site probably null
IGL02239:Serpinb3a APN 1 107051688 missense probably benign 0.05
IGL02508:Serpinb3a APN 1 107046072 missense probably damaging 1.00
IGL02533:Serpinb3a APN 1 107047162 missense probably benign 0.00
IGL02860:Serpinb3a APN 1 107049453 splice site probably benign
IGL03013:Serpinb3a APN 1 107046083 missense probably damaging 1.00
IGL03391:Serpinb3a APN 1 107046342 missense possibly damaging 0.81
R0321:Serpinb3a UTSW 1 107047482 nonsense probably null
R0416:Serpinb3a UTSW 1 107049386 missense probably benign 0.29
R0494:Serpinb3a UTSW 1 107047482 nonsense probably null
R0498:Serpinb3a UTSW 1 107047150 missense probably damaging 1.00
R1223:Serpinb3a UTSW 1 107047552 missense probably damaging 1.00
R1596:Serpinb3a UTSW 1 107047174 missense probably benign 0.12
R1655:Serpinb3a UTSW 1 107046212 missense probably damaging 1.00
R2156:Serpinb3a UTSW 1 107047472 critical splice donor site probably null
R2296:Serpinb3a UTSW 1 107047561 missense probably damaging 1.00
R4327:Serpinb3a UTSW 1 107051770 start codon destroyed probably damaging 1.00
R4612:Serpinb3a UTSW 1 107047607 missense probably damaging 0.99
R4830:Serpinb3a UTSW 1 107048586 missense probably benign 0.00
R5016:Serpinb3a UTSW 1 107046330 missense probably damaging 1.00
R5483:Serpinb3a UTSW 1 107047169 missense probably benign 0.16
R5619:Serpinb3a UTSW 1 107047108 missense probably damaging 1.00
R7227:Serpinb3a UTSW 1 107051629 missense probably damaging 1.00
R8277:Serpinb3a UTSW 1 107046240 missense probably damaging 1.00
Z1177:Serpinb3a UTSW 1 107051008 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTCTTGAAGATGTGAAGGAACC -3'
(R):5'- GCAGGCTAGGGAAAATCCTG -3'

Sequencing Primer
(F):5'- TCTTGAAGATGTGAAGGAACCAAAAG -3'
(R):5'- AGCATTTCCTCCATTGAATACGTG -3'
Posted On2021-03-05