Mutagenetix > Incidental Mutation

Incidental Mutation 'R8468:Epha5'

660812

Institutional Source

Beutler Lab

Gene Symbol

Epha5

Ensembl Gene

ENSMUSG00000029245

Gene Name

Eph receptor A5

Synonyms

Rek7, Ehk1, Hek7, Cek7, bsk, Els1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8468 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84054761-84417382 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 84142416 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000109033 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]

AlphaFold

Q60629

Predicted Effect

probably benign
Transcript: ENSMUST00000053733

SMART Domains

Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	307	387	1.92e-12	SMART
Pfam:EphA2_TM	413	511	2.1e-22	PFAM
TyrKc	514	771	9.33e-138	SMART
SAM	801	868	6.65e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113398

SMART Domains

Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	359	439	1.92e-12	SMART
Pfam:EphA2_TM	465	563	8.4e-23	PFAM
TyrKc	566	823	9.33e-138	SMART
Pfam:SAM_1	854	894	7.2e-11	PFAM
Pfam:SAM_2	856	894	1.6e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113399

SMART Domains

Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	360	450	1.53e-6	SMART
FN3	471	551	1.92e-12	SMART
Pfam:EphA2_TM	577	675	3.4e-22	PFAM
TyrKc	678	935	9.33e-138	SMART
Pfam:SAM_1	966	1006	2.9e-10	PFAM
Pfam:SAM_2	968	1006	5.9e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000113401

SMART Domains

Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	307	387	1.92e-12	SMART
Pfam:EphA2_TM	411	488	3.1e-30	PFAM
TyrKc	491	748	9.33e-138	SMART
Pfam:SAM_1	779	819	1.7e-10	PFAM
Pfam:SAM_2	781	819	3.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113403

SMART Domains

Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	360	450	1.53e-6	SMART
FN3	471	551	1.92e-12	SMART
Pfam:EphA2_TM	577	675	1.2e-25	PFAM
TyrKc	678	935	9.33e-138	SMART
SAM	965	1032	6.65e-23	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113406

SMART Domains

Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	42	57	N/A	INTRINSIC
EPH_lbd	62	235	7e-122	SMART
FN3	360	450	1.53e-6	SMART
FN3	471	551	1.92e-12	SMART
Pfam:EphA2_TM	575	652	1.9e-30	PFAM
TyrKc	655	912	9.33e-138	SMART
SAM	942	1009	6.65e-23	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	A	G	16: 85,795,556	W655R	possibly damaging	Het
Adamts3	C	T	5: 89,694,768	A748T	probably benign	Het
Ano1	A	C	7: 144,655,620	F248C	probably damaging	Het
Ap2b1	T	A	11: 83,351,065	L628Q	probably damaging	Het
BC035947	C	A	1: 78,498,330	A522S	probably damaging	Het
Bdp1	A	G	13: 100,060,568	V1103A	probably benign	Het
Cd248	T	A	19: 5,069,882	I586N	possibly damaging	Het
Dnah9	C	A	11: 65,831,730	M4428I	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fastkd2	T	A	1: 63,731,764	L93Q	probably benign	Het
Gm6665	T	C	18: 31,820,400	D5G	possibly damaging	Het
Gphn	T	C	12: 78,226,827	V17A	probably benign	Het
Gpr85	A	T	6: 13,836,296	L203H	probably damaging	Het
Grk6	A	G	13: 55,451,385	Y166C	probably damaging	Het
Ints3	A	G	3: 90,406,253	V356A	probably damaging	Het
Krt33b	G	A	11: 100,029,789	R13C	probably damaging	Het
Lgals3	A	G	14: 47,381,647	I146V	possibly damaging	Het
Lrp1	G	A	10: 127,558,650	R2565C	probably damaging	Het
Miip	G	T	4: 147,861,471	D325E	probably damaging	Het
Naaladl1	T	A	19: 6,108,585	V249E	probably damaging	Het
Nfxl1	C	T	5: 72,518,205	R811K	possibly damaging	Het
Olfr1145	T	C	2: 87,810,738	I306T	possibly damaging	Het
Olfr676	A	T	7: 105,035,746	I183F	probably damaging	Het
Olfr681	A	G	7: 105,121,478	D7G	probably benign	Het
Olfr701	A	G	7: 106,818,839	Y252C	possibly damaging	Het
Olfr822	C	T	10: 130,074,434	T8I	probably benign	Het
Olfr994	T	A	2: 85,430,178	Y217F	probably damaging	Het
Pkd2l2	A	G	18: 34,427,411	D357G	possibly damaging	Het
Ppp1r36	A	G	12: 76,436,205	Y189C	probably damaging	Het
Rev3l	A	G	10: 39,827,991	E2011G	probably damaging	Het
Sestd1	T	A	2: 77,191,746	T534S	probably benign	Het
Sfmbt1	G	A	14: 30,773,984	A75T	probably benign	Het
Smarcc2	G	A	10: 128,484,393	R882H	probably benign	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Speg	C	T	1: 75,431,309	A3216V	probably damaging	Het
Vmn1r12	A	G	6: 57,159,385	T112A	probably benign	Het
Zfp937	T	G	2: 150,238,714	D221E	probably benign	Het

Other mutations in Epha5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00808:Epha5	APN	5	84106700	missense	probably damaging	1.00
IGL01084:Epha5	APN	5	84071087	nonsense	probably null
IGL01462:Epha5	APN	5	84071233	missense	probably damaging	1.00
IGL01516:Epha5	APN	5	84386276	missense	probably damaging	1.00
IGL01998:Epha5	APN	5	84084734	missense	probably damaging	1.00
IGL02744:Epha5	APN	5	84107989	missense	probably benign	0.22
IGL03076:Epha5	APN	5	84331690	missense	probably damaging	1.00
IGL03123:Epha5	APN	5	84331226	critical splice donor site	probably null
IGL03381:Epha5	APN	5	84331332	missense	probably damaging	0.98
BB001:Epha5	UTSW	5	84084846	missense	possibly damaging	0.71
BB011:Epha5	UTSW	5	84084846	missense	possibly damaging	0.71
PIT4544001:Epha5	UTSW	5	84331612	missense	possibly damaging	0.71
R0004:Epha5	UTSW	5	84331842	missense	probably damaging	1.00
R0490:Epha5	UTSW	5	84107974	splice site	probably benign
R0545:Epha5	UTSW	5	84067358	critical splice donor site	probably null
R0835:Epha5	UTSW	5	84386242	missense	probably damaging	1.00
R1074:Epha5	UTSW	5	84150395	missense	probably damaging	0.99
R1074:Epha5	UTSW	5	84150396	missense	probably damaging	0.99
R1075:Epha5	UTSW	5	84150395	missense	probably damaging	0.99
R1075:Epha5	UTSW	5	84150396	missense	probably damaging	0.99
R1102:Epha5	UTSW	5	84233575	splice site	probably benign
R1184:Epha5	UTSW	5	84071275	splice site	probably null
R1255:Epha5	UTSW	5	84150395	missense	probably damaging	0.99
R1255:Epha5	UTSW	5	84150396	missense	probably damaging	0.99
R1327:Epha5	UTSW	5	84106785	missense	probably damaging	1.00
R1437:Epha5	UTSW	5	84233696	missense	probably damaging	1.00
R1804:Epha5	UTSW	5	84331815	missense	probably benign	0.21
R1967:Epha5	UTSW	5	84416429	missense	probably benign	0.23
R2187:Epha5	UTSW	5	84086364	missense	probably damaging	1.00
R2282:Epha5	UTSW	5	84150410	missense	probably damaging	1.00
R2899:Epha5	UTSW	5	84233808	missense	probably damaging	0.99
R3746:Epha5	UTSW	5	84059104	missense	probably damaging	1.00
R4454:Epha5	UTSW	5	84156444	missense	probably damaging	1.00
R4771:Epha5	UTSW	5	84150419	missense	probably damaging	0.99
R4809:Epha5	UTSW	5	84105891	missense	possibly damaging	0.88
R4810:Epha5	UTSW	5	84105891	missense	possibly damaging	0.88
R4825:Epha5	UTSW	5	84233840	missense	probably damaging	0.97
R4833:Epha5	UTSW	5	84105891	missense	possibly damaging	0.88
R4961:Epha5	UTSW	5	84233643	missense	probably damaging	1.00
R4976:Epha5	UTSW	5	84084824	missense	probably damaging	1.00
R4981:Epha5	UTSW	5	84150483	missense	probably damaging	1.00
R5149:Epha5	UTSW	5	84150358	missense	probably damaging	1.00
R5422:Epha5	UTSW	5	84331490	missense	probably damaging	1.00
R5575:Epha5	UTSW	5	84416502	missense	probably damaging	0.97
R5664:Epha5	UTSW	5	84331866	missense	probably damaging	1.00
R5801:Epha5	UTSW	5	84331226	critical splice donor site	probably null
R5821:Epha5	UTSW	5	84084728	missense	probably damaging	1.00
R5924:Epha5	UTSW	5	84233674	nonsense	probably null
R5951:Epha5	UTSW	5	84331192	intron	probably benign
R5956:Epha5	UTSW	5	84150369	missense	probably damaging	0.99
R6127:Epha5	UTSW	5	84071094	missense	probably damaging	1.00
R6189:Epha5	UTSW	5	84237540	missense	probably damaging	1.00
R6240:Epha5	UTSW	5	84117579	missense	probably benign	0.27
R6343:Epha5	UTSW	5	84106747	missense	probably damaging	1.00
R6463:Epha5	UTSW	5	84106710	missense	probably damaging	1.00
R6517:Epha5	UTSW	5	84156501	missense	possibly damaging	0.63
R6622:Epha5	UTSW	5	84237528	missense	possibly damaging	0.79
R6667:Epha5	UTSW	5	84071191	missense	probably damaging	1.00
R6741:Epha5	UTSW	5	84106698	missense	possibly damaging	0.69
R6757:Epha5	UTSW	5	84105878	missense	probably damaging	1.00
R6762:Epha5	UTSW	5	84331726	missense	probably damaging	1.00
R6819:Epha5	UTSW	5	84106790	missense	probably damaging	1.00
R7019:Epha5	UTSW	5	84416462	missense	possibly damaging	0.68
R7031:Epha5	UTSW	5	84142300	missense	probably benign	0.12
R7213:Epha5	UTSW	5	84233923	splice site	probably null
R7728:Epha5	UTSW	5	84067408	missense	possibly damaging	0.95
R7924:Epha5	UTSW	5	84084846	missense	possibly damaging	0.71
R7953:Epha5	UTSW	5	84233654	missense	probably benign	0.19
R8043:Epha5	UTSW	5	84233654	missense	probably benign	0.19
R8558:Epha5	UTSW	5	84059116	missense	probably damaging	1.00
R8796:Epha5	UTSW	5	84107991	missense	probably damaging	0.97
R9035:Epha5	UTSW	5	84108027	missense	probably damaging	1.00
R9060:Epha5	UTSW	5	84071118	missense	probably benign	0.01
R9244:Epha5	UTSW	5	84117582	missense	probably benign	0.28
R9347:Epha5	UTSW	5	84331872	missense	possibly damaging	0.51
R9355:Epha5	UTSW	5	84106031	missense	probably damaging	1.00
R9434:Epha5	UTSW	5	84331368	missense	possibly damaging	0.72
Z1088:Epha5	UTSW	5	84237522	missense	probably benign	0.01
Z1176:Epha5	UTSW	5	84071120	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TTCATCGCTGGATCAAGGGG -3'
(R):5'- TTATGGCTGGCAGACACAATCAG -3'

Sequencing Primer
(F):5'- AAGAGAGCAGCTGCAGAGGTTC -3'
(R):5'- GGCAGACACAATCAGCATCTAGTG -3'

Posted On

2021-03-05