Incidental Mutation 'R8465:Gbp11'
ID 660813
Institutional Source Beutler Lab
Gene Symbol Gbp11
Ensembl Gene ENSMUSG00000092021
Gene Name guanylate binding protein 11
Synonyms Gm7141
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 105323042-105346472 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105325062 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 499 (D499N)
Ref Sequence ENSEMBL: ENSMUSP00000098520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100960] [ENSMUST00000171587]
AlphaFold A9YVJ5
Predicted Effect probably benign
Transcript: ENSMUST00000100960
AA Change: D499N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098520
Gene: ENSMUSG00000092021
AA Change: D499N

DomainStartEndE-ValueType
Pfam:GBP 16 279 1.5e-122 PFAM
Pfam:GBP_C 281 574 3.4e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171587
SMART Domains Protein: ENSMUSP00000132552
Gene: ENSMUSG00000092021

DomainStartEndE-ValueType
Pfam:GBP 16 279 4.9e-117 PFAM
Pfam:GBP_C 281 442 2.7e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,316,464 L23M possibly damaging Het
Acot6 A T 12: 84,106,441 probably null Het
Adamtsl3 A T 7: 82,598,122 N1429Y probably benign Het
Adk T C 14: 21,103,824 S32P possibly damaging Het
Akap13 A T 7: 75,727,038 M2005L probably benign Het
Atp10a A T 7: 58,828,310 D1367V probably benign Het
Bckdhb A G 9: 83,988,862 I142V probably benign Het
Brap C T 5: 121,679,295 Q322* probably null Het
Carmil3 A T 14: 55,496,848 N401I probably damaging Het
Cdan1 A T 2: 120,728,440 S426T possibly damaging Het
Cdc27 C A 11: 104,517,491 S531I probably benign Het
Cela3a A T 4: 137,403,874 Y184* probably null Het
Cep63 T C 9: 102,613,377 K178R probably benign Het
Cfb G A 17: 34,857,314 Q152* probably null Het
Cnpy2 G A 10: 128,326,175 V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,339,523 probably null Het
Ctc1 G A 11: 69,026,219 G67D probably damaging Het
Cwc27 G T 13: 104,804,264 P196T probably benign Het
Cwc27 C A 13: 104,804,268 L194F possibly damaging Het
Cyp2d12 T G 15: 82,555,177 S11A possibly damaging Het
Ddx55 T A 5: 124,559,121 probably null Het
Dedd2 G T 7: 25,218,906 R75S probably damaging Het
Fat2 G A 11: 55,256,704 S3904F possibly damaging Het
Fibp G A 19: 5,463,187 V177I probably damaging Het
Fsip2 A T 2: 82,979,940 E2201V probably benign Het
Gfm1 A G 3: 67,431,699 E45G probably damaging Het
Gm884 T A 11: 103,616,121 probably benign Het
H2-D1 A G 17: 35,263,511 Y69C probably damaging Het
Hcar1 A G 5: 123,879,046 F194S probably damaging Het
Heatr4 A T 12: 83,977,933 probably null Het
Kcnd2 G A 6: 21,216,696 C133Y probably damaging Het
Kcnq1 A T 7: 143,425,974 Q619L probably benign Het
Kctd12 T A 14: 102,981,465 R326W probably damaging Het
Kel A G 6: 41,689,538 probably null Het
Lipk A T 19: 34,046,797 I332F probably benign Het
Masp2 A G 4: 148,612,059 D371G possibly damaging Het
Met A G 6: 17,571,810 E1376G probably benign Het
Mup5 A T 4: 61,833,778 I78K probably benign Het
Mynn A T 3: 30,616,641 D526V probably damaging Het
Naip6 G T 13: 100,296,915 T1138N possibly damaging Het
Neurod1 G T 2: 79,454,352 P229Q probably damaging Het
Npepps T G 11: 97,248,259 R162S probably damaging Het
Ntrk3 T A 7: 78,462,883 Q175L probably damaging Het
Obsl1 T C 1: 75,503,388 T310A probably damaging Het
Olfr1062 A T 2: 86,423,631 M15K probably benign Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1288 A T 2: 111,479,080 T99S probably benign Het
Olfr25 A T 9: 38,330,114 I176F possibly damaging Het
Pigf G A 17: 86,997,536 T193I possibly damaging Het
Pkp4 T C 2: 59,342,181 V904A possibly damaging Het
Plekha6 C T 1: 133,270,040 T141M probably damaging Het
Rapgef6 G A 11: 54,691,482 D1407N probably benign Het
Rhobtb3 T C 13: 75,939,622 D82G probably damaging Het
Rims1 T C 1: 22,428,480 N767S possibly damaging Het
Ripor2 T A 13: 24,665,468 probably benign Het
Sec14l4 T A 11: 4,043,948 I296N probably damaging Het
Serpinb12 G T 1: 106,956,612 V363F probably damaging Het
Serpinb9c A G 13: 33,150,033 I342T probably damaging Het
Shmt2 A G 10: 127,520,076 V133A probably damaging Het
Slc30a6 A G 17: 74,415,666 M243V probably benign Het
Slfn2 T A 11: 83,069,661 N155K probably damaging Het
Syne2 A T 12: 75,854,124 D19V possibly damaging Het
Tcl1b3 A T 12: 105,194,477 I116L probably benign Het
Tcp11 A G 17: 28,067,792 I411T probably damaging Het
Tctn1 C T 5: 122,241,796 A560T probably benign Het
Tenm3 C A 8: 48,229,181 Q2471H probably damaging Het
Tnr A G 1: 159,886,075 D691G probably benign Het
Ube3b C T 5: 114,390,390 P150S probably damaging Het
Ugt2b5 T C 5: 87,139,659 I216M possibly damaging Het
Unc5d T A 8: 28,666,849 R789S probably damaging Het
Ush2a G A 1: 188,415,678 G934D probably damaging Het
Usp6nl A T 2: 6,394,541 R70S probably damaging Het
Vmn1r181 T C 7: 23,984,884 I258T possibly damaging Het
Vmn2r15 C A 5: 109,297,436 D41Y probably damaging Het
Vmn2r17 T A 5: 109,452,825 I663N probably damaging Het
Vnn3 C A 10: 23,865,882 Q362K possibly damaging Het
Wdr72 A G 9: 74,152,448 D380G possibly damaging Het
Wfdc10 G A 2: 164,657,260 E97K possibly damaging Het
Xdh A T 17: 73,899,012 C1002* probably null Het
Zscan4e A C 7: 11,307,651 V126G probably damaging Het
Other mutations in Gbp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Gbp11 APN 5 105327616 critical splice acceptor site probably null
IGL01347:Gbp11 APN 5 105331328 splice site probably benign
IGL01762:Gbp11 APN 5 105327607 missense probably benign
IGL02157:Gbp11 APN 5 105327508 missense possibly damaging 0.95
Quilt UTSW 5 105325508 missense probably damaging 1.00
Tilted UTSW 5 105331053 missense probably damaging 1.00
R0550:Gbp11 UTSW 5 105343750 missense probably benign 0.28
R0647:Gbp11 UTSW 5 105330964 missense possibly damaging 0.93
R1530:Gbp11 UTSW 5 105327489 missense probably damaging 0.99
R1612:Gbp11 UTSW 5 105326596 missense possibly damaging 0.72
R1677:Gbp11 UTSW 5 105327411 missense probably damaging 1.00
R1738:Gbp11 UTSW 5 105326644 missense probably benign 0.02
R2063:Gbp11 UTSW 5 105328584 nonsense probably null
R2869:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2869:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2870:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2870:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2873:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R3915:Gbp11 UTSW 5 105331112 missense probably damaging 1.00
R4854:Gbp11 UTSW 5 105325508 missense probably damaging 1.00
R5140:Gbp11 UTSW 5 105331053 missense probably damaging 1.00
R5534:Gbp11 UTSW 5 105331038 missense probably damaging 1.00
R6091:Gbp11 UTSW 5 105331388 missense possibly damaging 0.95
R6336:Gbp11 UTSW 5 105325489
R6351:Gbp11 UTSW 5 105327598 missense probably benign 0.07
R6956:Gbp11 UTSW 5 105328375 critical splice donor site probably null
R7371:Gbp11 UTSW 5 105342105 missense probably benign 0.06
R7393:Gbp11 UTSW 5 105327577 missense possibly damaging 0.60
R7410:Gbp11 UTSW 5 105343908 missense probably damaging 1.00
R7443:Gbp11 UTSW 5 105330950 critical splice donor site probably null
R7898:Gbp11 UTSW 5 105324932 missense probably benign 0.00
R8467:Gbp11 UTSW 5 105327591 missense probably damaging 1.00
R8672:Gbp11 UTSW 5 105343809 missense probably damaging 1.00
R8858:Gbp11 UTSW 5 105325526 nonsense probably null
R8960:Gbp11 UTSW 5 105331385 missense probably damaging 0.98
R9097:Gbp11 UTSW 5 105326481 makesense probably null
R9232:Gbp11 UTSW 5 105328424 missense possibly damaging 0.76
R9380:Gbp11 UTSW 5 105327336 missense probably benign 0.00
R9400:Gbp11 UTSW 5 105330975 missense probably damaging 1.00
R9438:Gbp11 UTSW 5 105326605 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACCTGGCTGACAACTTTCTCC -3'
(R):5'- AACATGCTCCCCAAGTGTGG -3'

Sequencing Primer
(F):5'- TCCTACAGCCTGGGGTACTAGAAC -3'
(R):5'- CAAGTGTGGACCAGAGTTGAGTC -3'
Posted On 2021-03-05