Incidental Mutation 'R8465:Gbp11'
ID 660813
Institutional Source Beutler Lab
Gene Symbol Gbp11
Ensembl Gene ENSMUSG00000092021
Gene Name guanylate binding protein 11
Synonyms Gm7141
MMRRC Submission 067909-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R8465 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 105470908-105494338 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105472928 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 499 (D499N)
Ref Sequence ENSEMBL: ENSMUSP00000098520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100960] [ENSMUST00000171587]
AlphaFold A9YVJ5
Predicted Effect probably benign
Transcript: ENSMUST00000100960
AA Change: D499N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098520
Gene: ENSMUSG00000092021
AA Change: D499N

DomainStartEndE-ValueType
Pfam:GBP 16 279 1.5e-122 PFAM
Pfam:GBP_C 281 574 3.4e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171587
SMART Domains Protein: ENSMUSP00000132552
Gene: ENSMUSG00000092021

DomainStartEndE-ValueType
Pfam:GBP 16 279 4.9e-117 PFAM
Pfam:GBP_C 281 442 2.7e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot6 A T 12: 84,153,215 (GRCm39) probably null Het
Adamtsl3 A T 7: 82,247,330 (GRCm39) N1429Y probably benign Het
Adk T C 14: 21,153,892 (GRCm39) S32P possibly damaging Het
Akap13 A T 7: 75,376,786 (GRCm39) M2005L probably benign Het
Atp10a A T 7: 58,478,058 (GRCm39) D1367V probably benign Het
Bckdhb A G 9: 83,870,915 (GRCm39) I142V probably benign Het
Brap C T 5: 121,817,358 (GRCm39) Q322* probably null Het
Carmil3 A T 14: 55,734,305 (GRCm39) N401I probably damaging Het
Cdan1 A T 2: 120,558,921 (GRCm39) S426T possibly damaging Het
Cdc27 C A 11: 104,408,317 (GRCm39) S531I probably benign Het
Cela3a A T 4: 137,131,185 (GRCm39) Y184* probably null Het
Cep63 T C 9: 102,490,576 (GRCm39) K178R probably benign Het
Cfb G A 17: 35,076,290 (GRCm39) Q152* probably null Het
Cnpy2 G A 10: 128,162,044 (GRCm39) V106I probably benign Het
Cntn1 GCTGTCTTC GC 15: 92,237,404 (GRCm39) probably null Het
Ctc1 G A 11: 68,917,045 (GRCm39) G67D probably damaging Het
Cwc27 G T 13: 104,940,772 (GRCm39) P196T probably benign Het
Cwc27 C A 13: 104,940,776 (GRCm39) L194F possibly damaging Het
Cyp2d12 T G 15: 82,439,378 (GRCm39) S11A possibly damaging Het
Ddx55 T A 5: 124,697,184 (GRCm39) probably null Het
Dedd2 G T 7: 24,918,331 (GRCm39) R75S probably damaging Het
Fat2 G A 11: 55,147,530 (GRCm39) S3904F possibly damaging Het
Fibp G A 19: 5,513,215 (GRCm39) V177I probably damaging Het
Fsip2 A T 2: 82,810,284 (GRCm39) E2201V probably benign Het
Gfm1 A G 3: 67,339,032 (GRCm39) E45G probably damaging Het
H2-D1 A G 17: 35,482,487 (GRCm39) Y69C probably damaging Het
Hcar1 A G 5: 124,017,109 (GRCm39) F194S probably damaging Het
Heatr4 A T 12: 84,024,707 (GRCm39) probably null Het
Kcnd2 G A 6: 21,216,695 (GRCm39) C133Y probably damaging Het
Kcnq1 A T 7: 142,979,711 (GRCm39) Q619L probably benign Het
Kctd12 T A 14: 103,218,901 (GRCm39) R326W probably damaging Het
Kel A G 6: 41,666,472 (GRCm39) probably null Het
Lipk A T 19: 34,024,197 (GRCm39) I332F probably benign Het
Lrrc37 T A 11: 103,506,947 (GRCm39) probably benign Het
Masp2 A G 4: 148,696,516 (GRCm39) D371G possibly damaging Het
Met A G 6: 17,571,809 (GRCm39) E1376G probably benign Het
Mup5 A T 4: 61,752,015 (GRCm39) I78K probably benign Het
Mynn A T 3: 30,670,790 (GRCm39) D526V probably damaging Het
Naip6 G T 13: 100,433,423 (GRCm39) T1138N possibly damaging Het
Neurod1 G T 2: 79,284,696 (GRCm39) P229Q probably damaging Het
Npepps T G 11: 97,139,085 (GRCm39) R162S probably damaging Het
Ntrk3 T A 7: 78,112,631 (GRCm39) Q175L probably damaging Het
Obsl1 T C 1: 75,480,032 (GRCm39) T310A probably damaging Het
Or4g7 A T 2: 111,309,425 (GRCm39) T99S probably benign Het
Or8c9 A T 9: 38,241,410 (GRCm39) I176F possibly damaging Het
Or8j3c A T 2: 86,253,975 (GRCm39) M15K probably benign Het
Or8k32 A G 2: 86,368,731 (GRCm39) I176T probably damaging Het
Pigf G A 17: 87,304,964 (GRCm39) T193I possibly damaging Het
Pkp4 T C 2: 59,172,525 (GRCm39) V904A possibly damaging Het
Plekha6 C T 1: 133,197,778 (GRCm39) T141M probably damaging Het
Rapgef6 G A 11: 54,582,308 (GRCm39) D1407N probably benign Het
Rhobtb3 T C 13: 76,087,741 (GRCm39) D82G probably damaging Het
Rims1 T C 1: 22,498,731 (GRCm39) N767S possibly damaging Het
Ripor2 T A 13: 24,849,451 (GRCm39) probably benign Het
Sec14l4 T A 11: 3,993,948 (GRCm39) I296N probably damaging Het
Serpinb12 G T 1: 106,884,342 (GRCm39) V363F probably damaging Het
Serpinb9c A G 13: 33,334,016 (GRCm39) I342T probably damaging Het
Shmt2 A G 10: 127,355,945 (GRCm39) V133A probably damaging Het
Slc30a6 A G 17: 74,722,661 (GRCm39) M243V probably benign Het
Slfn2 T A 11: 82,960,487 (GRCm39) N155K probably damaging Het
Spata31h1 A T 10: 82,152,298 (GRCm39) L23M possibly damaging Het
Syne2 A T 12: 75,900,898 (GRCm39) D19V possibly damaging Het
Tcl1b3 A T 12: 105,160,736 (GRCm39) I116L probably benign Het
Tcp11 A G 17: 28,286,766 (GRCm39) I411T probably damaging Het
Tctn1 C T 5: 122,379,859 (GRCm39) A560T probably benign Het
Tenm3 C A 8: 48,682,216 (GRCm39) Q2471H probably damaging Het
Tnr A G 1: 159,713,645 (GRCm39) D691G probably benign Het
Ube3b C T 5: 114,528,451 (GRCm39) P150S probably damaging Het
Ugt2b5 T C 5: 87,287,518 (GRCm39) I216M possibly damaging Het
Unc5d T A 8: 29,156,877 (GRCm39) R789S probably damaging Het
Ush2a G A 1: 188,147,875 (GRCm39) G934D probably damaging Het
Usp6nl A T 2: 6,399,352 (GRCm39) R70S probably damaging Het
Vmn1r181 T C 7: 23,684,309 (GRCm39) I258T possibly damaging Het
Vmn2r15 C A 5: 109,445,302 (GRCm39) D41Y probably damaging Het
Vmn2r17 T A 5: 109,600,691 (GRCm39) I663N probably damaging Het
Vnn3 C A 10: 23,741,780 (GRCm39) Q362K possibly damaging Het
Wdr72 A G 9: 74,059,730 (GRCm39) D380G possibly damaging Het
Wfdc10 G A 2: 164,499,180 (GRCm39) E97K possibly damaging Het
Xdh A T 17: 74,206,007 (GRCm39) C1002* probably null Het
Zscan4e A C 7: 11,041,578 (GRCm39) V126G probably damaging Het
Other mutations in Gbp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Gbp11 APN 5 105,475,482 (GRCm39) critical splice acceptor site probably null
IGL01347:Gbp11 APN 5 105,479,194 (GRCm39) splice site probably benign
IGL01762:Gbp11 APN 5 105,475,473 (GRCm39) missense probably benign
IGL02157:Gbp11 APN 5 105,475,374 (GRCm39) missense possibly damaging 0.95
Quilt UTSW 5 105,473,374 (GRCm39) missense probably damaging 1.00
Tilted UTSW 5 105,478,919 (GRCm39) missense probably damaging 1.00
R0550:Gbp11 UTSW 5 105,491,616 (GRCm39) missense probably benign 0.28
R0647:Gbp11 UTSW 5 105,478,830 (GRCm39) missense possibly damaging 0.93
R1530:Gbp11 UTSW 5 105,475,355 (GRCm39) missense probably damaging 0.99
R1612:Gbp11 UTSW 5 105,474,462 (GRCm39) missense possibly damaging 0.72
R1677:Gbp11 UTSW 5 105,475,277 (GRCm39) missense probably damaging 1.00
R1738:Gbp11 UTSW 5 105,474,510 (GRCm39) missense probably benign 0.02
R2063:Gbp11 UTSW 5 105,476,450 (GRCm39) nonsense probably null
R2869:Gbp11 UTSW 5 105,478,866 (GRCm39) missense probably benign 0.00
R2869:Gbp11 UTSW 5 105,478,866 (GRCm39) missense probably benign 0.00
R2870:Gbp11 UTSW 5 105,478,866 (GRCm39) missense probably benign 0.00
R2870:Gbp11 UTSW 5 105,478,866 (GRCm39) missense probably benign 0.00
R2873:Gbp11 UTSW 5 105,478,866 (GRCm39) missense probably benign 0.00
R3915:Gbp11 UTSW 5 105,478,978 (GRCm39) missense probably damaging 1.00
R4854:Gbp11 UTSW 5 105,473,374 (GRCm39) missense probably damaging 1.00
R5140:Gbp11 UTSW 5 105,478,919 (GRCm39) missense probably damaging 1.00
R5534:Gbp11 UTSW 5 105,478,904 (GRCm39) missense probably damaging 1.00
R6091:Gbp11 UTSW 5 105,479,254 (GRCm39) missense possibly damaging 0.95
R6336:Gbp11 UTSW 5 105,473,355 (GRCm39)
R6351:Gbp11 UTSW 5 105,475,464 (GRCm39) missense probably benign 0.07
R6956:Gbp11 UTSW 5 105,476,241 (GRCm39) critical splice donor site probably null
R7371:Gbp11 UTSW 5 105,489,971 (GRCm39) missense probably benign 0.06
R7393:Gbp11 UTSW 5 105,475,443 (GRCm39) missense possibly damaging 0.60
R7410:Gbp11 UTSW 5 105,491,774 (GRCm39) missense probably damaging 1.00
R7443:Gbp11 UTSW 5 105,478,816 (GRCm39) critical splice donor site probably null
R7898:Gbp11 UTSW 5 105,472,798 (GRCm39) missense probably benign 0.00
R8467:Gbp11 UTSW 5 105,475,457 (GRCm39) missense probably damaging 1.00
R8672:Gbp11 UTSW 5 105,491,675 (GRCm39) missense probably damaging 1.00
R8858:Gbp11 UTSW 5 105,473,392 (GRCm39) nonsense probably null
R8960:Gbp11 UTSW 5 105,479,251 (GRCm39) missense probably damaging 0.98
R9097:Gbp11 UTSW 5 105,474,347 (GRCm39) makesense probably null
R9232:Gbp11 UTSW 5 105,476,290 (GRCm39) missense possibly damaging 0.76
R9380:Gbp11 UTSW 5 105,475,202 (GRCm39) missense probably benign 0.00
R9400:Gbp11 UTSW 5 105,478,841 (GRCm39) missense probably damaging 1.00
R9438:Gbp11 UTSW 5 105,474,471 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACCTGGCTGACAACTTTCTCC -3'
(R):5'- AACATGCTCCCCAAGTGTGG -3'

Sequencing Primer
(F):5'- TCCTACAGCCTGGGGTACTAGAAC -3'
(R):5'- CAAGTGTGGACCAGAGTTGAGTC -3'
Posted On 2021-03-05