Incidental Mutation 'R8558:Or4a72'
ID 660828
Institutional Source Beutler Lab
Gene Symbol Or4a72
Ensembl Gene ENSMUSG00000111456
Gene Name olfactory receptor family 4 subfamily A member 72
Synonyms GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
MMRRC Submission 068521-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R8558 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 89405056-89406117 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89405329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 247 (L247P)
Ref Sequence ENSEMBL: ENSMUSP00000150791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
AlphaFold A0A1L1SQJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000214870
AA Change: L247P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217402
AA Change: L247P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,430,497 (GRCm39) R51S probably benign Het
1700067P10Rik G T 17: 48,400,849 (GRCm39) E45* probably null Het
Abcb5 T C 12: 118,841,566 (GRCm39) T960A probably benign Het
Abcc3 A G 11: 94,242,623 (GRCm39) probably null Het
Adamtsl3 A T 7: 82,077,600 (GRCm39) D95V possibly damaging Het
Ash1l T A 3: 88,891,713 (GRCm39) S1197R probably damaging Het
BC034090 T A 1: 155,097,085 (GRCm39) H671L possibly damaging Het
Bltp1 T A 3: 37,102,750 (GRCm39) M1443K Het
Btnl9 T C 11: 49,071,619 (GRCm39) E68G probably benign Het
C1qtnf1 A T 11: 118,339,149 (GRCm39) Y273F probably damaging Het
C4b A T 17: 34,955,541 (GRCm39) C714S probably damaging Het
Carmil1 G A 13: 24,209,863 (GRCm39) T1204I probably benign Het
Cdk12 T C 11: 98,101,915 (GRCm39) L591P unknown Het
Ces2f T A 8: 105,679,758 (GRCm39) L417* probably null Het
Chl1 T A 6: 103,685,390 (GRCm39) S810R probably benign Het
Ckap2 A G 8: 22,658,811 (GRCm39) V644A possibly damaging Het
Ctdsp2 T A 10: 126,829,746 (GRCm39) V126E probably damaging Het
Dok6 G T 18: 89,492,066 (GRCm39) H170Q probably damaging Het
Dynlrb1 T C 2: 155,084,728 (GRCm39) probably null Het
Eif5b T C 1: 38,083,795 (GRCm39) L757S probably damaging Het
Epas1 A C 17: 87,116,896 (GRCm39) T189P possibly damaging Het
Epha10 C A 4: 124,788,777 (GRCm39) N283K Het
Epha5 C A 5: 84,206,975 (GRCm39) G853C probably damaging Het
Gapvd1 A T 2: 34,594,493 (GRCm39) H831Q probably damaging Het
Gcnt3 T A 9: 69,941,996 (GRCm39) K191* probably null Het
Gm14226 T A 2: 154,866,909 (GRCm39) S289T probably benign Het
Gm4846 T A 1: 166,314,674 (GRCm39) D323V probably damaging Het
Golga3 G T 5: 110,356,421 (GRCm39) R1036L possibly damaging Het
Gopc T C 10: 52,229,580 (GRCm39) Q213R probably damaging Het
Hrh1 G A 6: 114,457,564 (GRCm39) V282M probably benign Het
Ighv5-4 T C 12: 113,561,078 (GRCm39) Y114C probably damaging Het
Igkv10-94 A T 6: 68,681,636 (GRCm39) I68N probably damaging Het
Kcnj3 A G 2: 55,336,875 (GRCm39) D247G possibly damaging Het
Lcn6 C A 2: 25,570,718 (GRCm39) S102Y probably damaging Het
Matk C A 10: 81,096,765 (GRCm39) H232N probably benign Het
Mcm9 C T 10: 53,492,068 (GRCm39) V366I probably benign Het
Nadk A G 4: 155,669,844 (GRCm39) I176V probably benign Het
Nlrp12 A G 7: 3,298,111 (GRCm39) L20P probably damaging Het
Oga T C 19: 45,746,511 (GRCm39) S763G probably benign Het
Or10ag56 A T 2: 87,139,583 (GRCm39) Q170L probably benign Het
Or1e21 G A 11: 73,344,309 (GRCm39) S243F probably damaging Het
Pcdhgb6 T A 18: 37,877,237 (GRCm39) D648E probably damaging Het
Pkd1l3 A T 8: 110,362,012 (GRCm39) N1018I probably damaging Het
Plch2 T C 4: 155,083,391 (GRCm39) K516E probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Pnma2 C T 14: 67,153,972 (GRCm39) A132V probably benign Het
Prkn T C 17: 11,456,472 (GRCm39) S99P probably benign Het
Prune2 A G 19: 17,099,602 (GRCm39) E1702G probably damaging Het
Qars1 T A 9: 108,392,422 (GRCm39) H756Q probably benign Het
Rab5a A G 17: 53,790,877 (GRCm39) probably benign Het
Rars2 A G 4: 34,657,199 (GRCm39) D515G probably damaging Het
Rpe65 T A 3: 159,320,429 (GRCm39) C329S probably damaging Het
Rps6ka2 G A 17: 7,523,316 (GRCm39) V231M possibly damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,229,114 (GRCm39) probably benign Het
Scrt1 G T 15: 76,403,843 (GRCm39) S49* probably null Het
Sec23b C G 2: 144,428,308 (GRCm39) D640E possibly damaging Het
Setdb1 C T 3: 95,261,979 (GRCm39) V96M possibly damaging Het
Sik3 C A 9: 46,066,746 (GRCm39) A175E probably damaging Het
Smarcad1 A G 6: 65,060,908 (GRCm39) K463E probably benign Het
Sobp A C 10: 43,003,888 (GRCm39) C154G probably damaging Het
Sox6 A G 7: 115,141,033 (GRCm39) S482P probably benign Het
Spen C T 4: 141,197,681 (GRCm39) A3396T probably benign Het
Spink11 T A 18: 44,324,748 (GRCm39) R75* probably null Het
Sptb T C 12: 76,659,561 (GRCm39) H1113R probably benign Het
Sypl2 A T 3: 108,125,004 (GRCm39) V119E probably damaging Het
Tbc1d24 T C 17: 24,427,903 (GRCm39) S20G unknown Het
Tektl1 T C 10: 78,583,035 (GRCm39) K450E probably damaging Het
Top2a A T 11: 98,912,549 (GRCm39) V106D probably damaging Het
Tspyl4 G C 10: 34,174,261 (GRCm39) R251P probably damaging Het
Ttc21a T A 9: 119,787,835 (GRCm39) L801Q probably damaging Het
Vgll3 A G 16: 65,624,844 (GRCm39) E64G probably damaging Het
Vmn2r30 A G 7: 7,315,655 (GRCm39) I726T possibly damaging Het
Vmn2r81 T C 10: 79,106,467 (GRCm39) S482P possibly damaging Het
Wasf1 T G 10: 40,806,648 (GRCm39) M97R possibly damaging Het
Wdr33 T A 18: 31,962,947 (GRCm39) M98K probably benign Het
Wdr73 G A 7: 80,548,254 (GRCm39) T95I probably damaging Het
Other mutations in Or4a72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Or4a72 APN 2 89,405,767 (GRCm39) missense possibly damaging 0.68
IGL01690:Or4a72 APN 2 89,405,557 (GRCm39) missense probably benign 0.09
IGL02334:Or4a72 APN 2 89,405,668 (GRCm39) missense possibly damaging 0.95
IGL02435:Or4a72 APN 2 89,405,890 (GRCm39) missense probably damaging 0.99
IGL02793:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL02875:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL03218:Or4a72 APN 2 89,405,935 (GRCm39) missense probably benign 0.09
IGL03392:Or4a72 APN 2 89,405,593 (GRCm39) missense probably damaging 0.96
H8786:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
I0000:Or4a72 UTSW 2 89,405,497 (GRCm39) missense probably damaging 1.00
R0044:Or4a72 UTSW 2 89,405,974 (GRCm39) missense possibly damaging 0.68
R0190:Or4a72 UTSW 2 89,405,302 (GRCm39) missense probably damaging 0.98
R1585:Or4a72 UTSW 2 89,405,746 (GRCm39) missense possibly damaging 0.89
R1902:Or4a72 UTSW 2 89,405,947 (GRCm39) missense possibly damaging 0.77
R2018:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2019:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2020:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2021:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2030:Or4a72 UTSW 2 89,405,558 (GRCm39) missense probably benign 0.00
R2133:Or4a72 UTSW 2 89,405,600 (GRCm39) nonsense probably null
R3850:Or4a72 UTSW 2 89,405,378 (GRCm39) missense probably damaging 0.99
R4066:Or4a72 UTSW 2 89,405,523 (GRCm39) missense probably damaging 1.00
R4754:Or4a72 UTSW 2 89,405,391 (GRCm39) missense probably benign
R4923:Or4a72 UTSW 2 89,406,023 (GRCm39) missense probably damaging 0.98
R5303:Or4a72 UTSW 2 89,405,345 (GRCm39) missense possibly damaging 0.88
R5574:Or4a72 UTSW 2 89,405,321 (GRCm39) missense possibly damaging 0.94
R6083:Or4a72 UTSW 2 89,406,016 (GRCm39) missense probably benign 0.42
R6188:Or4a72 UTSW 2 89,405,538 (GRCm39) nonsense probably null
R6724:Or4a72 UTSW 2 89,405,309 (GRCm39) missense probably benign 0.26
R6964:Or4a72 UTSW 2 89,405,333 (GRCm39) missense probably benign
R7066:Or4a72 UTSW 2 89,406,047 (GRCm39) missense probably damaging 0.98
R7401:Or4a72 UTSW 2 89,405,449 (GRCm39) missense probably benign 0.27
R8232:Or4a72 UTSW 2 89,405,938 (GRCm39) missense noncoding transcript
R8708:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
R9482:Or4a72 UTSW 2 89,405,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATAGAATTTTGCACCAGAGC -3'
(R):5'- GACTGGTGGTTTTACACACTCTC -3'

Sequencing Primer
(F):5'- GCACCAGAGCTTTTTCATACAAG -3'
(R):5'- TGGTACTTGCATGCACAGAC -3'
Posted On 2021-03-08