Mutagenetix > Incidental Mutation

Incidental Mutation 'R8558:Rpe65'

660836

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.230) question?

Stock #

R8558 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 159614792 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 329 (C329S)

Ref Sequence

ENSEMBL: ENSMUSP00000029824 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]

AlphaFold

Q91ZQ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000029824
AA Change: C329S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: C329S

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000196999
AA Change: C329S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: C329S

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	A	T	10: 100,594,635	R51S	probably benign	Het
1700067P10Rik	G	T	17: 48,090,329	E45*	probably null	Het
4932438A13Rik	T	A	3: 37,048,601	M1443K		Het
Abcb5	T	C	12: 118,877,831	T960A	probably benign	Het
Abcc3	A	G	11: 94,351,797		probably null	Het
Adamtsl3	A	T	7: 82,428,392	D95V	possibly damaging	Het
Ash1l	T	A	3: 88,984,406	S1197R	probably damaging	Het
BC034090	T	A	1: 155,221,339	H671L	possibly damaging	Het
Btnl9	T	C	11: 49,180,792	E68G	probably benign	Het
C1qtnf1	A	T	11: 118,448,323	Y273F	probably damaging	Het
C4b	A	T	17: 34,736,567	C714S	probably damaging	Het
Carmil1	G	A	13: 24,025,880	T1204I	probably benign	Het
Ccdc105	T	C	10: 78,747,201	K450E	probably damaging	Het
Cdk12	T	C	11: 98,211,089	L591P	unknown	Het
Ces2f	T	A	8: 104,953,126	L417*	probably null	Het
Chl1	T	A	6: 103,708,429	S810R	probably benign	Het
Ckap2	A	G	8: 22,168,795	V644A	possibly damaging	Het
Ctdsp2	T	A	10: 126,993,877	V126E	probably damaging	Het
Dok6	G	T	18: 89,473,942	H170Q	probably damaging	Het
Dynlrb1	T	C	2: 155,242,808		probably null	Het
Eif5b	T	C	1: 38,044,714	L757S	probably damaging	Het
Epas1	A	C	17: 86,809,468	T189P	possibly damaging	Het
Epha10	C	A	4: 124,894,984	N283K		Het
Epha5	C	A	5: 84,059,116	G853C	probably damaging	Het
Gapvd1	A	T	2: 34,704,481	H831Q	probably damaging	Het
Gcnt3	T	A	9: 70,034,714	K191*	probably null	Het
Gm14226	T	A	2: 155,024,989	S289T	probably benign	Het
Gm4846	T	A	1: 166,487,105	D323V	probably damaging	Het
Golga3	G	T	5: 110,208,555	R1036L	possibly damaging	Het
Gopc	T	C	10: 52,353,484	Q213R	probably damaging	Het
Hrh1	G	A	6: 114,480,603	V282M	probably benign	Het
Ighv5-4	T	C	12: 113,597,458	Y114C	probably damaging	Het
Igkv10-94	A	T	6: 68,704,652	I68N	probably damaging	Het
Kcnj3	A	G	2: 55,446,863	D247G	possibly damaging	Het
Lcn6	C	A	2: 25,680,706	S102Y	probably damaging	Het
Matk	C	A	10: 81,260,931	H232N	probably benign	Het
Mcm9	C	T	10: 53,615,972	V366I	probably benign	Het
Mgea5	T	C	19: 45,758,072	S763G	probably benign	Het
Nadk	A	G	4: 155,585,387	I176V	probably benign	Het
Nlrp12	A	G	7: 3,249,481	L20P	probably damaging	Het
Olfr1118	A	T	2: 87,309,239	Q170L	probably benign	Het
Olfr1245	A	G	2: 89,574,985	L247P	probably damaging	Het
Olfr380	G	A	11: 73,453,483	S243F	probably damaging	Het
Park2	T	C	17: 11,237,585	S99P	probably benign	Het
Pcdhgb6	T	A	18: 37,744,184	D648E	probably damaging	Het
Pkd1l3	A	T	8: 109,635,380	N1018I	probably damaging	Het
Plch2	T	C	4: 154,998,934	K516E	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pnma2	C	T	14: 66,916,523	A132V	probably benign	Het
Prune2	A	G	19: 17,122,238	E1702G	probably damaging	Het
Qars	T	A	9: 108,515,223	H756Q	probably benign	Het
Rab5a	A	G	17: 53,483,849		probably benign	Het
Rars2	A	G	4: 34,657,199	D515G	probably damaging	Het
Rps6ka2	G	A	17: 7,255,917	V231M	possibly damaging	Het
Rsf1	GCG	GCGACGGCGCCG	7: 97,579,907		probably benign	Het
Scrt1	G	T	15: 76,519,643	S49*	probably null	Het
Sec23b	C	G	2: 144,586,388	D640E	possibly damaging	Het
Setdb1	C	T	3: 95,354,668	V96M	possibly damaging	Het
Sik3	C	A	9: 46,155,448	A175E	probably damaging	Het
Smarcad1	A	G	6: 65,083,924	K463E	probably benign	Het
Sobp	A	C	10: 43,127,892	C154G	probably damaging	Het
Sox6	A	G	7: 115,541,798	S482P	probably benign	Het
Spen	C	T	4: 141,470,370	A3396T	probably benign	Het
Spink11	T	A	18: 44,191,681	R75*	probably null	Het
Sptb	T	C	12: 76,612,787	H1113R	probably benign	Het
Sypl2	A	T	3: 108,217,688	V119E	probably damaging	Het
Tbc1d24	T	C	17: 24,208,929	S20G	unknown	Het
Top2a	A	T	11: 99,021,723	V106D	probably damaging	Het
Tspyl4	G	C	10: 34,298,265	R251P	probably damaging	Het
Ttc21a	T	A	9: 119,958,769	L801Q	probably damaging	Het
Vgll3	A	G	16: 65,827,958	E64G	probably damaging	Het
Vmn2r30	A	G	7: 7,312,656	I726T	possibly damaging	Het
Vmn2r81	T	C	10: 79,270,633	S482P	possibly damaging	Het
Wasf1	T	G	10: 40,930,652	M97R	possibly damaging	Het
Wdr33	T	A	18: 31,829,894	M98K	probably benign	Het
Wdr73	G	A	7: 80,898,506	T95I	probably damaging	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00
R9483:Rpe65	UTSW	3	159622681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGAGTCCAATGAAAGCATGG -3'
(R):5'- TTAGGCCTGGTTCAGATCAAG -3'

Sequencing Primer
(F):5'- AAAGCATGGGGGTATGTCTGATTC -3'
(R):5'- CCTGGTTCAGATCAAGTTGGTTTTC -3'

Posted On

2021-03-08