Incidental Mutation 'R8558:Rpe65'
ID 660836
Institutional Source Beutler Lab
Gene Symbol Rpe65
Ensembl Gene ENSMUSG00000028174
Gene Name retinal pigment epithelium 65
Synonyms A930029L06Rik, Mord1, rd12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock # R8558 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 159599175-159625321 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 159614792 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 329 (C329S)
Ref Sequence ENSEMBL: ENSMUSP00000029824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]
AlphaFold Q91ZQ5
Predicted Effect probably damaging
Transcript: ENSMUST00000029824
AA Change: C329S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: C329S

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196999
AA Change: C329S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: C329S

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,594,635 R51S probably benign Het
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932438A13Rik T A 3: 37,048,601 M1443K Het
Abcb5 T C 12: 118,877,831 T960A probably benign Het
Abcc3 A G 11: 94,351,797 probably null Het
Adamtsl3 A T 7: 82,428,392 D95V possibly damaging Het
Ash1l T A 3: 88,984,406 S1197R probably damaging Het
BC034090 T A 1: 155,221,339 H671L possibly damaging Het
Btnl9 T C 11: 49,180,792 E68G probably benign Het
C1qtnf1 A T 11: 118,448,323 Y273F probably damaging Het
C4b A T 17: 34,736,567 C714S probably damaging Het
Carmil1 G A 13: 24,025,880 T1204I probably benign Het
Ccdc105 T C 10: 78,747,201 K450E probably damaging Het
Cdk12 T C 11: 98,211,089 L591P unknown Het
Ces2f T A 8: 104,953,126 L417* probably null Het
Chl1 T A 6: 103,708,429 S810R probably benign Het
Ckap2 A G 8: 22,168,795 V644A possibly damaging Het
Ctdsp2 T A 10: 126,993,877 V126E probably damaging Het
Dok6 G T 18: 89,473,942 H170Q probably damaging Het
Dynlrb1 T C 2: 155,242,808 probably null Het
Eif5b T C 1: 38,044,714 L757S probably damaging Het
Epas1 A C 17: 86,809,468 T189P possibly damaging Het
Epha10 C A 4: 124,894,984 N283K Het
Epha5 C A 5: 84,059,116 G853C probably damaging Het
Gapvd1 A T 2: 34,704,481 H831Q probably damaging Het
Gcnt3 T A 9: 70,034,714 K191* probably null Het
Gm14226 T A 2: 155,024,989 S289T probably benign Het
Gm4846 T A 1: 166,487,105 D323V probably damaging Het
Golga3 G T 5: 110,208,555 R1036L possibly damaging Het
Gopc T C 10: 52,353,484 Q213R probably damaging Het
Hrh1 G A 6: 114,480,603 V282M probably benign Het
Ighv5-4 T C 12: 113,597,458 Y114C probably damaging Het
Igkv10-94 A T 6: 68,704,652 I68N probably damaging Het
Kcnj3 A G 2: 55,446,863 D247G possibly damaging Het
Lcn6 C A 2: 25,680,706 S102Y probably damaging Het
Matk C A 10: 81,260,931 H232N probably benign Het
Mcm9 C T 10: 53,615,972 V366I probably benign Het
Mgea5 T C 19: 45,758,072 S763G probably benign Het
Nadk A G 4: 155,585,387 I176V probably benign Het
Nlrp12 A G 7: 3,249,481 L20P probably damaging Het
Olfr1118 A T 2: 87,309,239 Q170L probably benign Het
Olfr1245 A G 2: 89,574,985 L247P probably damaging Het
Olfr380 G A 11: 73,453,483 S243F probably damaging Het
Park2 T C 17: 11,237,585 S99P probably benign Het
Pcdhgb6 T A 18: 37,744,184 D648E probably damaging Het
Pkd1l3 A T 8: 109,635,380 N1018I probably damaging Het
Plch2 T C 4: 154,998,934 K516E probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pnma2 C T 14: 66,916,523 A132V probably benign Het
Prune2 A G 19: 17,122,238 E1702G probably damaging Het
Qars T A 9: 108,515,223 H756Q probably benign Het
Rab5a A G 17: 53,483,849 probably benign Het
Rars2 A G 4: 34,657,199 D515G probably damaging Het
Rps6ka2 G A 17: 7,255,917 V231M possibly damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Scrt1 G T 15: 76,519,643 S49* probably null Het
Sec23b C G 2: 144,586,388 D640E possibly damaging Het
Setdb1 C T 3: 95,354,668 V96M possibly damaging Het
Sik3 C A 9: 46,155,448 A175E probably damaging Het
Smarcad1 A G 6: 65,083,924 K463E probably benign Het
Sobp A C 10: 43,127,892 C154G probably damaging Het
Sox6 A G 7: 115,541,798 S482P probably benign Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Spink11 T A 18: 44,191,681 R75* probably null Het
Sptb T C 12: 76,612,787 H1113R probably benign Het
Sypl2 A T 3: 108,217,688 V119E probably damaging Het
Tbc1d24 T C 17: 24,208,929 S20G unknown Het
Top2a A T 11: 99,021,723 V106D probably damaging Het
Tspyl4 G C 10: 34,298,265 R251P probably damaging Het
Ttc21a T A 9: 119,958,769 L801Q probably damaging Het
Vgll3 A G 16: 65,827,958 E64G probably damaging Het
Vmn2r30 A G 7: 7,312,656 I726T possibly damaging Het
Vmn2r81 T C 10: 79,270,633 S482P possibly damaging Het
Wasf1 T G 10: 40,930,652 M97R possibly damaging Het
Wdr33 T A 18: 31,829,894 M98K probably benign Het
Wdr73 G A 7: 80,898,506 T95I probably damaging Het
Other mutations in Rpe65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rpe65 APN 3 159614542 missense probably damaging 0.99
IGL01446:Rpe65 APN 3 159600405 splice site probably benign
IGL01815:Rpe65 APN 3 159604530 splice site probably null
IGL02085:Rpe65 APN 3 159615646 missense probably benign 0.00
IGL02232:Rpe65 APN 3 159604351 missense possibly damaging 0.93
IGL02248:Rpe65 APN 3 159624705 missense probably damaging 1.00
IGL02645:Rpe65 APN 3 159606491 missense probably damaging 0.99
IGL02711:Rpe65 APN 3 159622877 missense possibly damaging 0.84
IGL02982:Rpe65 APN 3 159600361 missense probably damaging 0.99
IGL03280:Rpe65 APN 3 159604341 missense probably damaging 0.96
IGL03350:Rpe65 APN 3 159614517 missense possibly damaging 0.75
IGL03356:Rpe65 APN 3 159615577 missense possibly damaging 0.89
I1329:Rpe65 UTSW 3 159624723 missense probably benign 0.35
R0571:Rpe65 UTSW 3 159600349 missense probably damaging 1.00
R0905:Rpe65 UTSW 3 159601583 missense possibly damaging 0.95
R1024:Rpe65 UTSW 3 159606485 missense probably benign 0.07
R1597:Rpe65 UTSW 3 159614784 missense probably damaging 0.97
R1657:Rpe65 UTSW 3 159614448 missense probably damaging 0.97
R1778:Rpe65 UTSW 3 159622848 missense probably damaging 1.00
R1970:Rpe65 UTSW 3 159615670 missense probably benign
R2259:Rpe65 UTSW 3 159615571 missense probably damaging 1.00
R3012:Rpe65 UTSW 3 159604563 missense possibly damaging 0.61
R3923:Rpe65 UTSW 3 159604400 missense probably benign 0.16
R3975:Rpe65 UTSW 3 159604585 missense probably damaging 1.00
R4204:Rpe65 UTSW 3 159604410 missense probably damaging 0.99
R4825:Rpe65 UTSW 3 159624681 missense probably benign
R4924:Rpe65 UTSW 3 159622631 missense probably benign 0.01
R5269:Rpe65 UTSW 3 159604347 missense probably benign 0.07
R5324:Rpe65 UTSW 3 159604404 missense possibly damaging 0.94
R5441:Rpe65 UTSW 3 159604401 missense probably damaging 1.00
R5854:Rpe65 UTSW 3 159615676 missense probably benign
R5907:Rpe65 UTSW 3 159615682 critical splice donor site probably null
R6149:Rpe65 UTSW 3 159614143 missense probably benign
R6660:Rpe65 UTSW 3 159614708 missense probably damaging 0.98
R6830:Rpe65 UTSW 3 159614168 missense probably benign 0.06
R7025:Rpe65 UTSW 3 159622685 missense probably damaging 1.00
R7092:Rpe65 UTSW 3 159615591 missense probably damaging 1.00
R7203:Rpe65 UTSW 3 159622854 missense probably damaging 0.99
R7366:Rpe65 UTSW 3 159624729 missense probably benign 0.13
R7537:Rpe65 UTSW 3 159604609 missense probably damaging 0.98
R7679:Rpe65 UTSW 3 159604393 missense probably damaging 1.00
R8044:Rpe65 UTSW 3 159614705 missense probably benign
R8179:Rpe65 UTSW 3 159624699 missense probably benign 0.06
R8409:Rpe65 UTSW 3 159614148 missense probably benign 0.01
R9042:Rpe65 UTSW 3 159615655 missense probably damaging 1.00
R9483:Rpe65 UTSW 3 159622681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGTCCAATGAAAGCATGG -3'
(R):5'- TTAGGCCTGGTTCAGATCAAG -3'

Sequencing Primer
(F):5'- AAAGCATGGGGGTATGTCTGATTC -3'
(R):5'- CCTGGTTCAGATCAAGTTGGTTTTC -3'
Posted On 2021-03-08