Mutagenetix > Incidental Mutation

Incidental Mutation 'R8558:Golga3'

660843

Institutional Source

Beutler Lab

Gene Symbol

Golga3

Ensembl Gene

ENSMUSG00000029502

Gene Name

golgi autoantigen, golgin subfamily a, 3

Synonyms

repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2

MMRRC Submission

068521-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8558 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110176701-110226470 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 110208555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1036 (R1036L)

Ref Sequence

ENSEMBL: ENSMUSP00000108131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000031477
AA Change: R1076L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: R1076L

Domain	Start	End	E-Value	Type
internal_repeat_1	24	49	7.67e-5	PROSPERO
internal_repeat_1	91	116	7.67e-5	PROSPERO
low complexity region	232	245	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	312	321	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	422	441	N/A	INTRINSIC
internal_repeat_2	444	484	7.67e-5	PROSPERO
low complexity region	534	548	N/A	INTRINSIC
internal_repeat_2	587	624	7.67e-5	PROSPERO
coiled coil region	656	1379	N/A	INTRINSIC
coiled coil region	1417	1453	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112512
AA Change: R1036L

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: R1036L

Domain	Start	End	E-Value	Type
internal_repeat_2	3	24	9.29e-5	PROSPERO
low complexity region	192	205	N/A	INTRINSIC
low complexity region	229	248	N/A	INTRINSIC
low complexity region	272	281	N/A	INTRINSIC
low complexity region	322	335	N/A	INTRINSIC
low complexity region	382	401	N/A	INTRINSIC
internal_repeat_1	404	444	4.91e-5	PROSPERO
low complexity region	494	508	N/A	INTRINSIC
internal_repeat_1	547	584	4.91e-5	PROSPERO
low complexity region	705	717	N/A	INTRINSIC
low complexity region	792	809	N/A	INTRINSIC
low complexity region	1105	1117	N/A	INTRINSIC
low complexity region	1220	1228	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
internal_repeat_2	1333	1359	9.29e-5	PROSPERO
coiled coil region	1377	1413	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	A	T	10: 100,594,635	R51S	probably benign	Het
1700067P10Rik	G	T	17: 48,090,329	E45*	probably null	Het
4932438A13Rik	T	A	3: 37,048,601	M1443K		Het
Abcb5	T	C	12: 118,877,831	T960A	probably benign	Het
Abcc3	A	G	11: 94,351,797		probably null	Het
Adamtsl3	A	T	7: 82,428,392	D95V	possibly damaging	Het
Ash1l	T	A	3: 88,984,406	S1197R	probably damaging	Het
BC034090	T	A	1: 155,221,339	H671L	possibly damaging	Het
Btnl9	T	C	11: 49,180,792	E68G	probably benign	Het
C1qtnf1	A	T	11: 118,448,323	Y273F	probably damaging	Het
C4b	A	T	17: 34,736,567	C714S	probably damaging	Het
Carmil1	G	A	13: 24,025,880	T1204I	probably benign	Het
Ccdc105	T	C	10: 78,747,201	K450E	probably damaging	Het
Cdk12	T	C	11: 98,211,089	L591P	unknown	Het
Ces2f	T	A	8: 104,953,126	L417*	probably null	Het
Chl1	T	A	6: 103,708,429	S810R	probably benign	Het
Ckap2	A	G	8: 22,168,795	V644A	possibly damaging	Het
Ctdsp2	T	A	10: 126,993,877	V126E	probably damaging	Het
Dok6	G	T	18: 89,473,942	H170Q	probably damaging	Het
Dynlrb1	T	C	2: 155,242,808		probably null	Het
Eif5b	T	C	1: 38,044,714	L757S	probably damaging	Het
Epas1	A	C	17: 86,809,468	T189P	possibly damaging	Het
Epha10	C	A	4: 124,894,984	N283K		Het
Epha5	C	A	5: 84,059,116	G853C	probably damaging	Het
Gapvd1	A	T	2: 34,704,481	H831Q	probably damaging	Het
Gcnt3	T	A	9: 70,034,714	K191*	probably null	Het
Gm14226	T	A	2: 155,024,989	S289T	probably benign	Het
Gm4846	T	A	1: 166,487,105	D323V	probably damaging	Het
Gopc	T	C	10: 52,353,484	Q213R	probably damaging	Het
Hrh1	G	A	6: 114,480,603	V282M	probably benign	Het
Ighv5-4	T	C	12: 113,597,458	Y114C	probably damaging	Het
Igkv10-94	A	T	6: 68,704,652	I68N	probably damaging	Het
Kcnj3	A	G	2: 55,446,863	D247G	possibly damaging	Het
Lcn6	C	A	2: 25,680,706	S102Y	probably damaging	Het
Matk	C	A	10: 81,260,931	H232N	probably benign	Het
Mcm9	C	T	10: 53,615,972	V366I	probably benign	Het
Mgea5	T	C	19: 45,758,072	S763G	probably benign	Het
Nadk	A	G	4: 155,585,387	I176V	probably benign	Het
Nlrp12	A	G	7: 3,249,481	L20P	probably damaging	Het
Olfr1118	A	T	2: 87,309,239	Q170L	probably benign	Het
Olfr1245	A	G	2: 89,574,985	L247P	probably damaging	Het
Olfr380	G	A	11: 73,453,483	S243F	probably damaging	Het
Park2	T	C	17: 11,237,585	S99P	probably benign	Het
Pcdhgb6	T	A	18: 37,744,184	D648E	probably damaging	Het
Pkd1l3	A	T	8: 109,635,380	N1018I	probably damaging	Het
Plch2	T	C	4: 154,998,934	K516E	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pnma2	C	T	14: 66,916,523	A132V	probably benign	Het
Prune2	A	G	19: 17,122,238	E1702G	probably damaging	Het
Qars	T	A	9: 108,515,223	H756Q	probably benign	Het
Rab5a	A	G	17: 53,483,849		probably benign	Het
Rars2	A	G	4: 34,657,199	D515G	probably damaging	Het
Rpe65	T	A	3: 159,614,792	C329S	probably damaging	Het
Rps6ka2	G	A	17: 7,255,917	V231M	possibly damaging	Het
Rsf1	GCG	GCGACGGCGCCG	7: 97,579,907		probably benign	Het
Scrt1	G	T	15: 76,519,643	S49*	probably null	Het
Sec23b	C	G	2: 144,586,388	D640E	possibly damaging	Het
Setdb1	C	T	3: 95,354,668	V96M	possibly damaging	Het
Sik3	C	A	9: 46,155,448	A175E	probably damaging	Het
Smarcad1	A	G	6: 65,083,924	K463E	probably benign	Het
Sobp	A	C	10: 43,127,892	C154G	probably damaging	Het
Sox6	A	G	7: 115,541,798	S482P	probably benign	Het
Spen	C	T	4: 141,470,370	A3396T	probably benign	Het
Spink11	T	A	18: 44,191,681	R75*	probably null	Het
Sptb	T	C	12: 76,612,787	H1113R	probably benign	Het
Sypl2	A	T	3: 108,217,688	V119E	probably damaging	Het
Tbc1d24	T	C	17: 24,208,929	S20G	unknown	Het
Top2a	A	T	11: 99,021,723	V106D	probably damaging	Het
Tspyl4	G	C	10: 34,298,265	R251P	probably damaging	Het
Ttc21a	T	A	9: 119,958,769	L801Q	probably damaging	Het
Vgll3	A	G	16: 65,827,958	E64G	probably damaging	Het
Vmn2r30	A	G	7: 7,312,656	I726T	possibly damaging	Het
Vmn2r81	T	C	10: 79,270,633	S482P	possibly damaging	Het
Wasf1	T	G	10: 40,930,652	M97R	possibly damaging	Het
Wdr33	T	A	18: 31,829,894	M98K	probably benign	Het
Wdr73	G	A	7: 80,898,506	T95I	probably damaging	Het

Other mutations in Golga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Golga3	APN	5	110220887	missense	probably damaging	1.00
IGL00594:Golga3	APN	5	110204975	missense	probably benign	0.37
IGL00672:Golga3	APN	5	110212244	missense	probably damaging	1.00
IGL00821:Golga3	APN	5	110204933	missense	possibly damaging	0.74
IGL01015:Golga3	APN	5	110187717	missense	probably benign	0.04
IGL01408:Golga3	APN	5	110217809	critical splice acceptor site	probably null
IGL01651:Golga3	APN	5	110192905	critical splice acceptor site	probably null
IGL02617:Golga3	APN	5	110188746	missense	probably benign	0.26
cles	UTSW	5	110188707	nonsense	probably null
tenta	UTSW	5	110218130	nonsense	probably null
PIT4544001:Golga3	UTSW	5	110188690	missense	possibly damaging	0.94
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0591:Golga3	UTSW	5	110188743	missense	probably damaging	1.00
R1219:Golga3	UTSW	5	110184349	nonsense	probably null
R1297:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1299:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1589:Golga3	UTSW	5	110181783	missense	probably damaging	1.00
R1795:Golga3	UTSW	5	110207627	missense	possibly damaging	0.47
R1992:Golga3	UTSW	5	110192973	missense	probably damaging	0.96
R2116:Golga3	UTSW	5	110187395	missense	probably damaging	0.97
R2130:Golga3	UTSW	5	110202939	critical splice donor site	probably null
R2153:Golga3	UTSW	5	110187990	splice site	probably null
R2158:Golga3	UTSW	5	110187361	missense	probably damaging	1.00
R2357:Golga3	UTSW	5	110202648	missense	probably damaging	1.00
R2397:Golga3	UTSW	5	110205877	splice site	probably benign
R2418:Golga3	UTSW	5	110201868	missense	probably damaging	1.00
R2495:Golga3	UTSW	5	110207596	missense	probably damaging	0.99
R2763:Golga3	UTSW	5	110204895	missense	possibly damaging	0.87
R3276:Golga3	UTSW	5	110201998	splice site	probably benign
R3614:Golga3	UTSW	5	110220908	missense	probably damaging	1.00
R4520:Golga3	UTSW	5	110203751	nonsense	probably null
R5001:Golga3	UTSW	5	110205777	missense	probably damaging	1.00
R5046:Golga3	UTSW	5	110192940	missense	probably damaging	0.99
R5157:Golga3	UTSW	5	110202671	missense	probably benign	0.00
R5191:Golga3	UTSW	5	110184307	intron	probably benign
R5376:Golga3	UTSW	5	110220945	critical splice donor site	probably null
R5399:Golga3	UTSW	5	110205024	missense	probably damaging	0.96
R5407:Golga3	UTSW	5	110201990	nonsense	probably null
R5884:Golga3	UTSW	5	110216895	missense	probably damaging	1.00
R6087:Golga3	UTSW	5	110204946	missense	probably damaging	0.99
R6526:Golga3	UTSW	5	110204895	missense	probably damaging	0.98
R6651:Golga3	UTSW	5	110218130	nonsense	probably null
R7041:Golga3	UTSW	5	110208584	critical splice donor site	probably null
R7057:Golga3	UTSW	5	110188663	missense	probably damaging	1.00
R7078:Golga3	UTSW	5	110193087	missense	probably damaging	0.99
R7114:Golga3	UTSW	5	110202712	missense	probably benign	0.01
R7190:Golga3	UTSW	5	110209855	missense	probably damaging	1.00
R7405:Golga3	UTSW	5	110208446	missense	probably damaging	0.97
R7528:Golga3	UTSW	5	110212232	missense	probably damaging	1.00
R7638:Golga3	UTSW	5	110205828	missense	probably benign
R7760:Golga3	UTSW	5	110205850	missense	probably benign	0.39
R8099:Golga3	UTSW	5	110188707	nonsense	probably null
R8144:Golga3	UTSW	5	110185879	missense	probably damaging	0.99
R8708:Golga3	UTSW	5	110202855	missense	probably benign	0.05
R8887:Golga3	UTSW	5	110205760	intron	probably benign
R9039:Golga3	UTSW	5	110204933	missense	probably benign	0.00
R9045:Golga3	UTSW	5	110193097	missense	probably benign	0.00
R9057:Golga3	UTSW	5	110184599	missense	probably damaging	1.00
R9100:Golga3	UTSW	5	110189678	missense	probably benign	0.31
R9112:Golga3	UTSW	5	110185891	missense	probably benign	0.08
R9198:Golga3	UTSW	5	110207753	missense	probably benign	0.11
R9755:Golga3	UTSW	5	110192981	missense	probably benign	0.42

Predicted Primers

PCR Primer
(F):5'- TGATCAGGTATGTGTCCATGAG -3'
(R):5'- GCTATAGGCTAGACACATCTGCC -3'

Sequencing Primer
(F):5'- CAGGTATGTGTCCATGAGAGTTGAAG -3'
(R):5'- TGCCTCCAAATGTCTCAGTAG -3'

Posted On

2021-03-08