Incidental Mutation 'R8558:Wdr73'
ID 660850
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene Name WD repeat domain 73
Synonyms 1200011I23Rik, 2410008B13Rik
MMRRC Submission 068521-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.259) question?
Stock # R8558 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 80540471-80551017 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80548254 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 95 (T95I)
Ref Sequence ENSEMBL: ENSMUSP00000026816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816] [ENSMUST00000026817] [ENSMUST00000119428]
AlphaFold Q9CWR1
Predicted Effect probably damaging
Transcript: ENSMUST00000026816
AA Change: T95I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722
AA Change: T95I

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026817
SMART Domains Protein: ENSMUSP00000026817
Gene: ENSMUSG00000025723

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Bombesin 47 60 3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119428
SMART Domains Protein: ENSMUSP00000113407
Gene: ENSMUSG00000025723

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Bombesin 47 60 1.4e-12 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722
AA Change: T93I

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,430,497 (GRCm39) R51S probably benign Het
1700067P10Rik G T 17: 48,400,849 (GRCm39) E45* probably null Het
Abcb5 T C 12: 118,841,566 (GRCm39) T960A probably benign Het
Abcc3 A G 11: 94,242,623 (GRCm39) probably null Het
Adamtsl3 A T 7: 82,077,600 (GRCm39) D95V possibly damaging Het
Ash1l T A 3: 88,891,713 (GRCm39) S1197R probably damaging Het
BC034090 T A 1: 155,097,085 (GRCm39) H671L possibly damaging Het
Bltp1 T A 3: 37,102,750 (GRCm39) M1443K Het
Btnl9 T C 11: 49,071,619 (GRCm39) E68G probably benign Het
C1qtnf1 A T 11: 118,339,149 (GRCm39) Y273F probably damaging Het
C4b A T 17: 34,955,541 (GRCm39) C714S probably damaging Het
Carmil1 G A 13: 24,209,863 (GRCm39) T1204I probably benign Het
Cdk12 T C 11: 98,101,915 (GRCm39) L591P unknown Het
Ces2f T A 8: 105,679,758 (GRCm39) L417* probably null Het
Chl1 T A 6: 103,685,390 (GRCm39) S810R probably benign Het
Ckap2 A G 8: 22,658,811 (GRCm39) V644A possibly damaging Het
Ctdsp2 T A 10: 126,829,746 (GRCm39) V126E probably damaging Het
Dok6 G T 18: 89,492,066 (GRCm39) H170Q probably damaging Het
Dynlrb1 T C 2: 155,084,728 (GRCm39) probably null Het
Eif5b T C 1: 38,083,795 (GRCm39) L757S probably damaging Het
Epas1 A C 17: 87,116,896 (GRCm39) T189P possibly damaging Het
Epha10 C A 4: 124,788,777 (GRCm39) N283K Het
Epha5 C A 5: 84,206,975 (GRCm39) G853C probably damaging Het
Gapvd1 A T 2: 34,594,493 (GRCm39) H831Q probably damaging Het
Gcnt3 T A 9: 69,941,996 (GRCm39) K191* probably null Het
Gm14226 T A 2: 154,866,909 (GRCm39) S289T probably benign Het
Gm4846 T A 1: 166,314,674 (GRCm39) D323V probably damaging Het
Golga3 G T 5: 110,356,421 (GRCm39) R1036L possibly damaging Het
Gopc T C 10: 52,229,580 (GRCm39) Q213R probably damaging Het
Hrh1 G A 6: 114,457,564 (GRCm39) V282M probably benign Het
Ighv5-4 T C 12: 113,561,078 (GRCm39) Y114C probably damaging Het
Igkv10-94 A T 6: 68,681,636 (GRCm39) I68N probably damaging Het
Kcnj3 A G 2: 55,336,875 (GRCm39) D247G possibly damaging Het
Lcn6 C A 2: 25,570,718 (GRCm39) S102Y probably damaging Het
Matk C A 10: 81,096,765 (GRCm39) H232N probably benign Het
Mcm9 C T 10: 53,492,068 (GRCm39) V366I probably benign Het
Nadk A G 4: 155,669,844 (GRCm39) I176V probably benign Het
Nlrp12 A G 7: 3,298,111 (GRCm39) L20P probably damaging Het
Oga T C 19: 45,746,511 (GRCm39) S763G probably benign Het
Or10ag56 A T 2: 87,139,583 (GRCm39) Q170L probably benign Het
Or1e21 G A 11: 73,344,309 (GRCm39) S243F probably damaging Het
Or4a72 A G 2: 89,405,329 (GRCm39) L247P probably damaging Het
Pcdhgb6 T A 18: 37,877,237 (GRCm39) D648E probably damaging Het
Pkd1l3 A T 8: 110,362,012 (GRCm39) N1018I probably damaging Het
Plch2 T C 4: 155,083,391 (GRCm39) K516E probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Pnma2 C T 14: 67,153,972 (GRCm39) A132V probably benign Het
Prkn T C 17: 11,456,472 (GRCm39) S99P probably benign Het
Prune2 A G 19: 17,099,602 (GRCm39) E1702G probably damaging Het
Qars1 T A 9: 108,392,422 (GRCm39) H756Q probably benign Het
Rab5a A G 17: 53,790,877 (GRCm39) probably benign Het
Rars2 A G 4: 34,657,199 (GRCm39) D515G probably damaging Het
Rpe65 T A 3: 159,320,429 (GRCm39) C329S probably damaging Het
Rps6ka2 G A 17: 7,523,316 (GRCm39) V231M possibly damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,229,114 (GRCm39) probably benign Het
Scrt1 G T 15: 76,403,843 (GRCm39) S49* probably null Het
Sec23b C G 2: 144,428,308 (GRCm39) D640E possibly damaging Het
Setdb1 C T 3: 95,261,979 (GRCm39) V96M possibly damaging Het
Sik3 C A 9: 46,066,746 (GRCm39) A175E probably damaging Het
Smarcad1 A G 6: 65,060,908 (GRCm39) K463E probably benign Het
Sobp A C 10: 43,003,888 (GRCm39) C154G probably damaging Het
Sox6 A G 7: 115,141,033 (GRCm39) S482P probably benign Het
Spen C T 4: 141,197,681 (GRCm39) A3396T probably benign Het
Spink11 T A 18: 44,324,748 (GRCm39) R75* probably null Het
Sptb T C 12: 76,659,561 (GRCm39) H1113R probably benign Het
Sypl2 A T 3: 108,125,004 (GRCm39) V119E probably damaging Het
Tbc1d24 T C 17: 24,427,903 (GRCm39) S20G unknown Het
Tektl1 T C 10: 78,583,035 (GRCm39) K450E probably damaging Het
Top2a A T 11: 98,912,549 (GRCm39) V106D probably damaging Het
Tspyl4 G C 10: 34,174,261 (GRCm39) R251P probably damaging Het
Ttc21a T A 9: 119,787,835 (GRCm39) L801Q probably damaging Het
Vgll3 A G 16: 65,624,844 (GRCm39) E64G probably damaging Het
Vmn2r30 A G 7: 7,315,655 (GRCm39) I726T possibly damaging Het
Vmn2r81 T C 10: 79,106,467 (GRCm39) S482P possibly damaging Het
Wasf1 T G 10: 40,806,648 (GRCm39) M97R possibly damaging Het
Wdr33 T A 18: 31,962,947 (GRCm39) M98K probably benign Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80,543,411 (GRCm39) missense probably benign 0.01
IGL02183:Wdr73 APN 7 80,543,508 (GRCm39) missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80,547,694 (GRCm39) missense probably benign 0.00
3-1:Wdr73 UTSW 7 80,547,707 (GRCm39) missense possibly damaging 0.91
R0469:Wdr73 UTSW 7 80,547,698 (GRCm39) nonsense probably null
R0507:Wdr73 UTSW 7 80,541,594 (GRCm39) missense possibly damaging 0.88
R0510:Wdr73 UTSW 7 80,547,698 (GRCm39) nonsense probably null
R1349:Wdr73 UTSW 7 80,543,000 (GRCm39) missense probably damaging 1.00
R1782:Wdr73 UTSW 7 80,541,526 (GRCm39) missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80,543,081 (GRCm39) missense probably benign 0.17
R3085:Wdr73 UTSW 7 80,550,990 (GRCm39) unclassified probably benign
R4478:Wdr73 UTSW 7 80,542,969 (GRCm39) missense probably benign 0.06
R4479:Wdr73 UTSW 7 80,542,969 (GRCm39) missense probably benign 0.06
R4480:Wdr73 UTSW 7 80,542,969 (GRCm39) missense probably benign 0.06
R4910:Wdr73 UTSW 7 80,541,456 (GRCm39) missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80,542,943 (GRCm39) missense probably benign 0.00
R5046:Wdr73 UTSW 7 80,542,173 (GRCm39) unclassified probably benign
R5286:Wdr73 UTSW 7 80,541,557 (GRCm39) missense probably benign 0.04
R5842:Wdr73 UTSW 7 80,541,458 (GRCm39) missense probably damaging 1.00
R6991:Wdr73 UTSW 7 80,541,604 (GRCm39) missense probably benign 0.17
R7182:Wdr73 UTSW 7 80,543,426 (GRCm39) missense possibly damaging 0.45
R7197:Wdr73 UTSW 7 80,542,946 (GRCm39) missense probably benign 0.02
R7362:Wdr73 UTSW 7 80,550,451 (GRCm39) missense probably damaging 1.00
R7771:Wdr73 UTSW 7 80,542,975 (GRCm39) missense probably benign 0.13
R8950:Wdr73 UTSW 7 80,550,131 (GRCm39) missense probably benign 0.00
X0022:Wdr73 UTSW 7 80,547,699 (GRCm39) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ACGGACTTGTAGGCTCTACTAG -3'
(R):5'- TGCTCATCTGGAAAGCAGGTG -3'

Sequencing Primer
(F):5'- GGCTCTACTAGTCAAAATGTCTGC -3'
(R):5'- GCTGGAATTTGAACTCAGGACCTTC -3'
Posted On 2021-03-08