Incidental Mutation 'R8558:Wdr73'
ID 660850
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene Name WD repeat domain 73
Synonyms 2410008B13Rik, 1200011I23Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028026; MGI: 1919218

Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock # R8558 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 80890723-80901269 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80898506 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 95 (T95I)
Ref Sequence ENSEMBL: ENSMUSP00000026816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816] [ENSMUST00000026817] [ENSMUST00000119428]
AlphaFold Q9CWR1
Predicted Effect probably damaging
Transcript: ENSMUST00000026816
AA Change: T95I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722
AA Change: T95I

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026817
SMART Domains Protein: ENSMUSP00000026817
Gene: ENSMUSG00000025723

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Bombesin 47 60 3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119428
SMART Domains Protein: ENSMUSP00000113407
Gene: ENSMUSG00000025723

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Bombesin 47 60 1.4e-12 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722
AA Change: T93I

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,594,635 R51S probably benign Het
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932438A13Rik T A 3: 37,048,601 M1443K Het
Abcb5 T C 12: 118,877,831 T960A probably benign Het
Abcc3 A G 11: 94,351,797 probably null Het
Adamtsl3 A T 7: 82,428,392 D95V possibly damaging Het
Ash1l T A 3: 88,984,406 S1197R probably damaging Het
BC034090 T A 1: 155,221,339 H671L possibly damaging Het
Btnl9 T C 11: 49,180,792 E68G probably benign Het
C1qtnf1 A T 11: 118,448,323 Y273F probably damaging Het
C4b A T 17: 34,736,567 C714S probably damaging Het
Carmil1 G A 13: 24,025,880 T1204I probably benign Het
Ccdc105 T C 10: 78,747,201 K450E probably damaging Het
Cdk12 T C 11: 98,211,089 L591P unknown Het
Ces2f T A 8: 104,953,126 L417* probably null Het
Chl1 T A 6: 103,708,429 S810R probably benign Het
Ckap2 A G 8: 22,168,795 V644A possibly damaging Het
Ctdsp2 T A 10: 126,993,877 V126E probably damaging Het
Dok6 G T 18: 89,473,942 H170Q probably damaging Het
Dynlrb1 T C 2: 155,242,808 probably null Het
Eif5b T C 1: 38,044,714 L757S probably damaging Het
Epas1 A C 17: 86,809,468 T189P possibly damaging Het
Epha10 C A 4: 124,894,984 N283K Het
Epha5 C A 5: 84,059,116 G853C probably damaging Het
Gapvd1 A T 2: 34,704,481 H831Q probably damaging Het
Gcnt3 T A 9: 70,034,714 K191* probably null Het
Gm14226 T A 2: 155,024,989 S289T probably benign Het
Gm4846 T A 1: 166,487,105 D323V probably damaging Het
Golga3 G T 5: 110,208,555 R1036L possibly damaging Het
Gopc T C 10: 52,353,484 Q213R probably damaging Het
Hrh1 G A 6: 114,480,603 V282M probably benign Het
Ighv5-4 T C 12: 113,597,458 Y114C probably damaging Het
Igkv10-94 A T 6: 68,704,652 I68N probably damaging Het
Kcnj3 A G 2: 55,446,863 D247G possibly damaging Het
Lcn6 C A 2: 25,680,706 S102Y probably damaging Het
Matk C A 10: 81,260,931 H232N probably benign Het
Mcm9 C T 10: 53,615,972 V366I probably benign Het
Mgea5 T C 19: 45,758,072 S763G probably benign Het
Nadk A G 4: 155,585,387 I176V probably benign Het
Nlrp12 A G 7: 3,249,481 L20P probably damaging Het
Olfr1118 A T 2: 87,309,239 Q170L probably benign Het
Olfr1245 A G 2: 89,574,985 L247P probably damaging Het
Olfr380 G A 11: 73,453,483 S243F probably damaging Het
Park2 T C 17: 11,237,585 S99P probably benign Het
Pcdhgb6 T A 18: 37,744,184 D648E probably damaging Het
Pkd1l3 A T 8: 109,635,380 N1018I probably damaging Het
Plch2 T C 4: 154,998,934 K516E probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pnma2 C T 14: 66,916,523 A132V probably benign Het
Prune2 A G 19: 17,122,238 E1702G probably damaging Het
Qars T A 9: 108,515,223 H756Q probably benign Het
Rab5a A G 17: 53,483,849 probably benign Het
Rars2 A G 4: 34,657,199 D515G probably damaging Het
Rpe65 T A 3: 159,614,792 C329S probably damaging Het
Rps6ka2 G A 17: 7,255,917 V231M possibly damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Scrt1 G T 15: 76,519,643 S49* probably null Het
Sec23b C G 2: 144,586,388 D640E possibly damaging Het
Setdb1 C T 3: 95,354,668 V96M possibly damaging Het
Sik3 C A 9: 46,155,448 A175E probably damaging Het
Smarcad1 A G 6: 65,083,924 K463E probably benign Het
Sobp A C 10: 43,127,892 C154G probably damaging Het
Sox6 A G 7: 115,541,798 S482P probably benign Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Spink11 T A 18: 44,191,681 R75* probably null Het
Sptb T C 12: 76,612,787 H1113R probably benign Het
Sypl2 A T 3: 108,217,688 V119E probably damaging Het
Tbc1d24 T C 17: 24,208,929 S20G unknown Het
Top2a A T 11: 99,021,723 V106D probably damaging Het
Tspyl4 G C 10: 34,298,265 R251P probably damaging Het
Ttc21a T A 9: 119,958,769 L801Q probably damaging Het
Vgll3 A G 16: 65,827,958 E64G probably damaging Het
Vmn2r30 A G 7: 7,312,656 I726T possibly damaging Het
Vmn2r81 T C 10: 79,270,633 S482P possibly damaging Het
Wasf1 T G 10: 40,930,652 M97R possibly damaging Het
Wdr33 T A 18: 31,829,894 M98K probably benign Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80893663 missense probably benign 0.01
IGL02183:Wdr73 APN 7 80893760 missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80897946 missense probably benign 0.00
3-1:Wdr73 UTSW 7 80897959 missense possibly damaging 0.91
R0469:Wdr73 UTSW 7 80897950 nonsense probably null
R0507:Wdr73 UTSW 7 80891846 missense possibly damaging 0.88
R0510:Wdr73 UTSW 7 80897950 nonsense probably null
R1349:Wdr73 UTSW 7 80893252 missense probably damaging 1.00
R1782:Wdr73 UTSW 7 80891778 missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80893333 missense probably benign 0.17
R3085:Wdr73 UTSW 7 80901242 unclassified probably benign
R4478:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4479:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4480:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4910:Wdr73 UTSW 7 80891708 missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80893195 missense probably benign 0.00
R5046:Wdr73 UTSW 7 80892425 unclassified probably benign
R5286:Wdr73 UTSW 7 80891809 missense probably benign 0.04
R5842:Wdr73 UTSW 7 80891710 missense probably damaging 1.00
R6991:Wdr73 UTSW 7 80891856 missense probably benign 0.17
R7182:Wdr73 UTSW 7 80893678 missense possibly damaging 0.45
R7197:Wdr73 UTSW 7 80893198 missense probably benign 0.02
R7362:Wdr73 UTSW 7 80900703 missense probably damaging 1.00
R7771:Wdr73 UTSW 7 80893227 missense probably benign 0.13
R8950:Wdr73 UTSW 7 80900383 missense probably benign 0.00
X0022:Wdr73 UTSW 7 80897951 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ACGGACTTGTAGGCTCTACTAG -3'
(R):5'- TGCTCATCTGGAAAGCAGGTG -3'

Sequencing Primer
(F):5'- GGCTCTACTAGTCAAAATGTCTGC -3'
(R):5'- GCTGGAATTTGAACTCAGGACCTTC -3'
Posted On 2021-03-08