Mutagenetix > Incidental Mutation

Incidental Mutation 'R8558:C4b'

660887

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

MMRRC Submission

068521-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8558 (G1)

Quality Score

194.009

Status

Not validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34736567 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 714 (C714S)

Ref Sequence

ENSEMBL: ENSMUSP00000069418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

AlphaFold

P01029

Predicted Effect

probably damaging
Transcript: ENSMUST00000069507
AA Change: C714S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: C714S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173057

SMART Domains

Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

Domain	Start	End	E-Value	Type
Pfam:A2M	1	62	6.5e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	A	T	10: 100,594,635	R51S	probably benign	Het
1700067P10Rik	G	T	17: 48,090,329	E45*	probably null	Het
4932438A13Rik	T	A	3: 37,048,601	M1443K		Het
Abcb5	T	C	12: 118,877,831	T960A	probably benign	Het
Abcc3	A	G	11: 94,351,797		probably null	Het
Adamtsl3	A	T	7: 82,428,392	D95V	possibly damaging	Het
Ash1l	T	A	3: 88,984,406	S1197R	probably damaging	Het
BC034090	T	A	1: 155,221,339	H671L	possibly damaging	Het
Btnl9	T	C	11: 49,180,792	E68G	probably benign	Het
C1qtnf1	A	T	11: 118,448,323	Y273F	probably damaging	Het
Carmil1	G	A	13: 24,025,880	T1204I	probably benign	Het
Ccdc105	T	C	10: 78,747,201	K450E	probably damaging	Het
Cdk12	T	C	11: 98,211,089	L591P	unknown	Het
Ces2f	T	A	8: 104,953,126	L417*	probably null	Het
Chl1	T	A	6: 103,708,429	S810R	probably benign	Het
Ckap2	A	G	8: 22,168,795	V644A	possibly damaging	Het
Ctdsp2	T	A	10: 126,993,877	V126E	probably damaging	Het
Dok6	G	T	18: 89,473,942	H170Q	probably damaging	Het
Dynlrb1	T	C	2: 155,242,808		probably null	Het
Eif5b	T	C	1: 38,044,714	L757S	probably damaging	Het
Epas1	A	C	17: 86,809,468	T189P	possibly damaging	Het
Epha10	C	A	4: 124,894,984	N283K		Het
Epha5	C	A	5: 84,059,116	G853C	probably damaging	Het
Gapvd1	A	T	2: 34,704,481	H831Q	probably damaging	Het
Gcnt3	T	A	9: 70,034,714	K191*	probably null	Het
Gm14226	T	A	2: 155,024,989	S289T	probably benign	Het
Gm4846	T	A	1: 166,487,105	D323V	probably damaging	Het
Golga3	G	T	5: 110,208,555	R1036L	possibly damaging	Het
Gopc	T	C	10: 52,353,484	Q213R	probably damaging	Het
Hrh1	G	A	6: 114,480,603	V282M	probably benign	Het
Ighv5-4	T	C	12: 113,597,458	Y114C	probably damaging	Het
Igkv10-94	A	T	6: 68,704,652	I68N	probably damaging	Het
Kcnj3	A	G	2: 55,446,863	D247G	possibly damaging	Het
Lcn6	C	A	2: 25,680,706	S102Y	probably damaging	Het
Matk	C	A	10: 81,260,931	H232N	probably benign	Het
Mcm9	C	T	10: 53,615,972	V366I	probably benign	Het
Mgea5	T	C	19: 45,758,072	S763G	probably benign	Het
Nadk	A	G	4: 155,585,387	I176V	probably benign	Het
Nlrp12	A	G	7: 3,249,481	L20P	probably damaging	Het
Olfr1118	A	T	2: 87,309,239	Q170L	probably benign	Het
Olfr1245	A	G	2: 89,574,985	L247P	probably damaging	Het
Olfr380	G	A	11: 73,453,483	S243F	probably damaging	Het
Park2	T	C	17: 11,237,585	S99P	probably benign	Het
Pcdhgb6	T	A	18: 37,744,184	D648E	probably damaging	Het
Pkd1l3	A	T	8: 109,635,380	N1018I	probably damaging	Het
Plch2	T	C	4: 154,998,934	K516E	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pnma2	C	T	14: 66,916,523	A132V	probably benign	Het
Prune2	A	G	19: 17,122,238	E1702G	probably damaging	Het
Qars	T	A	9: 108,515,223	H756Q	probably benign	Het
Rab5a	A	G	17: 53,483,849		probably benign	Het
Rars2	A	G	4: 34,657,199	D515G	probably damaging	Het
Rpe65	T	A	3: 159,614,792	C329S	probably damaging	Het
Rps6ka2	G	A	17: 7,255,917	V231M	possibly damaging	Het
Rsf1	GCG	GCGACGGCGCCG	7: 97,579,907		probably benign	Het
Scrt1	G	T	15: 76,519,643	S49*	probably null	Het
Sec23b	C	G	2: 144,586,388	D640E	possibly damaging	Het
Setdb1	C	T	3: 95,354,668	V96M	possibly damaging	Het
Sik3	C	A	9: 46,155,448	A175E	probably damaging	Het
Smarcad1	A	G	6: 65,083,924	K463E	probably benign	Het
Sobp	A	C	10: 43,127,892	C154G	probably damaging	Het
Sox6	A	G	7: 115,541,798	S482P	probably benign	Het
Spen	C	T	4: 141,470,370	A3396T	probably benign	Het
Spink11	T	A	18: 44,191,681	R75*	probably null	Het
Sptb	T	C	12: 76,612,787	H1113R	probably benign	Het
Sypl2	A	T	3: 108,217,688	V119E	probably damaging	Het
Tbc1d24	T	C	17: 24,208,929	S20G	unknown	Het
Top2a	A	T	11: 99,021,723	V106D	probably damaging	Het
Tspyl4	G	C	10: 34,298,265	R251P	probably damaging	Het
Ttc21a	T	A	9: 119,958,769	L801Q	probably damaging	Het
Vgll3	A	G	16: 65,827,958	E64G	probably damaging	Het
Vmn2r30	A	G	7: 7,312,656	I726T	possibly damaging	Het
Vmn2r81	T	C	10: 79,270,633	S482P	possibly damaging	Het
Wasf1	T	G	10: 40,930,652	M97R	possibly damaging	Het
Wdr33	T	A	18: 31,829,894	M98K	probably benign	Het
Wdr73	G	A	7: 80,898,506	T95I	probably damaging	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0391:C4b	UTSW	17	34735614	splice site	probably benign
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1588:C4b	UTSW	17	34741025	missense	probably benign
R1645:C4b	UTSW	17	34740597	missense	probably damaging	1.00
R1664:C4b	UTSW	17	34732978	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2057:C4b	UTSW	17	34728620	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4299:C4b	UTSW	17	34731144	missense	possibly damaging	0.52
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4411:C4b	UTSW	17	34728864	missense	probably damaging	1.00
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5384:C4b	UTSW	17	34737661	missense	possibly damaging	0.89
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6613:C4b	UTSW	17	34733565	missense	probably damaging	0.99
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7081:C4b	UTSW	17	34735443	missense	probably benign	0.27
R7105:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7296:C4b	UTSW	17	34743659	missense	probably damaging	1.00
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8853:C4b	UTSW	17	34729905	missense	possibly damaging	0.91
R8934:C4b	UTSW	17	34732984	missense	possibly damaging	0.78
R8944:C4b	UTSW	17	34742939	missense	probably benign	0.00
R8960:C4b	UTSW	17	34733918	missense	probably damaging	1.00
R8982:C4b	UTSW	17	34734364	critical splice donor site	probably null
R9104:C4b	UTSW	17	34729259	missense	probably benign	0.39
R9114:C4b	UTSW	17	34729430	missense	probably damaging	0.99
R9348:C4b	UTSW	17	34733185	missense	probably benign	0.01
R9428:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R9533:C4b	UTSW	17	34737724	nonsense	probably null
R9591:C4b	UTSW	17	34738955	missense	probably benign	0.00
R9678:C4b	UTSW	17	34741789	critical splice donor site	probably null
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GAATGTGTTGCCCTCTCAGG -3'
(R):5'- TTCCAGAAGGCTGTCAGTGAG -3'

Sequencing Primer
(F):5'- GCCCTCTCAGGCGTCAC -3'
(R):5'- AGCACTGGGAGCCATGTCTTG -3'

Posted On

2021-03-08