Incidental Mutation 'R8558:C4b'
ID660887
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8558 (G1)
Quality Score194.009
Status Not validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34736567 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 714 (C714S)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably damaging
Transcript: ENSMUST00000069507
AA Change: C714S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: C714S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,594,635 R51S probably benign Het
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932438A13Rik T A 3: 37,048,601 M1443K Het
Abcb5 T C 12: 118,877,831 T960A probably benign Het
Abcc3 A G 11: 94,351,797 probably null Het
Adamtsl3 A T 7: 82,428,392 D95V possibly damaging Het
Ash1l T A 3: 88,984,406 S1197R probably damaging Het
BC034090 T A 1: 155,221,339 H671L possibly damaging Het
Btnl9 T C 11: 49,180,792 E68G probably benign Het
C1qtnf1 A T 11: 118,448,323 Y273F probably damaging Het
Carmil1 G A 13: 24,025,880 T1204I probably benign Het
Ccdc105 T C 10: 78,747,201 K450E probably damaging Het
Cdk12 T C 11: 98,211,089 L591P unknown Het
Ces2f T A 8: 104,953,126 L417* probably null Het
Chl1 T A 6: 103,708,429 S810R probably benign Het
Ckap2 A G 8: 22,168,795 V644A possibly damaging Het
Ctdsp2 T A 10: 126,993,877 V126E probably damaging Het
Dok6 G T 18: 89,473,942 H170Q probably damaging Het
Dynlrb1 T C 2: 155,242,808 probably null Het
Eif5b T C 1: 38,044,714 L757S probably damaging Het
Epas1 A C 17: 86,809,468 T189P possibly damaging Het
Epha10 C A 4: 124,894,984 N283K Het
Epha5 C A 5: 84,059,116 G853C probably damaging Het
Gapvd1 A T 2: 34,704,481 H831Q probably damaging Het
Gcnt3 T A 9: 70,034,714 K191* probably null Het
Gm14226 T A 2: 155,024,989 S289T probably benign Het
Gm4846 T A 1: 166,487,105 D323V probably damaging Het
Golga3 G T 5: 110,208,555 R1036L possibly damaging Het
Gopc T C 10: 52,353,484 Q213R probably damaging Het
Hrh1 G A 6: 114,480,603 V282M probably benign Het
Ighv5-4 T C 12: 113,597,458 Y114C probably damaging Het
Igkv10-94 A T 6: 68,704,652 I68N probably damaging Het
Kcnj3 A G 2: 55,446,863 D247G possibly damaging Het
Lcn6 C A 2: 25,680,706 S102Y probably damaging Het
Matk C A 10: 81,260,931 H232N probably benign Het
Mcm9 C T 10: 53,615,972 V366I probably benign Het
Mgea5 T C 19: 45,758,072 S763G probably benign Het
Nadk A G 4: 155,585,387 I176V probably benign Het
Nlrp12 A G 7: 3,249,481 L20P probably damaging Het
Olfr1118 A T 2: 87,309,239 Q170L probably benign Het
Olfr1245 A G 2: 89,574,985 L247P probably damaging Het
Olfr380 G A 11: 73,453,483 S243F probably damaging Het
Park2 T C 17: 11,237,585 S99P probably benign Het
Pcdhgb6 T A 18: 37,744,184 D648E probably damaging Het
Pkd1l3 A T 8: 109,635,380 N1018I probably damaging Het
Plch2 T C 4: 154,998,934 K516E probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pnma2 C T 14: 66,916,523 A132V probably benign Het
Prune2 A G 19: 17,122,238 E1702G probably damaging Het
Qars T A 9: 108,515,223 H756Q probably benign Het
Rab5a A G 17: 53,483,849 probably benign Het
Rars2 A G 4: 34,657,199 D515G probably damaging Het
Rpe65 T A 3: 159,614,792 C329S probably damaging Het
Rps6ka2 G A 17: 7,255,917 V231M possibly damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Scrt1 G T 15: 76,519,643 S49* probably null Het
Sec23b C G 2: 144,586,388 D640E possibly damaging Het
Setdb1 C T 3: 95,354,668 V96M possibly damaging Het
Sik3 C A 9: 46,155,448 A175E probably damaging Het
Smarcad1 A G 6: 65,083,924 K463E probably benign Het
Sobp A C 10: 43,127,892 C154G probably damaging Het
Sox6 A G 7: 115,541,798 S482P probably benign Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Spink11 T A 18: 44,191,681 R75* probably null Het
Sptb T C 12: 76,612,787 H1113R probably benign Het
Sypl2 A T 3: 108,217,688 V119E probably damaging Het
Tbc1d24 T C 17: 24,208,929 S20G unknown Het
Top2a A T 11: 99,021,723 V106D probably damaging Het
Tspyl4 G C 10: 34,298,265 R251P probably damaging Het
Ttc21a T A 9: 119,958,769 L801Q probably damaging Het
Vgll3 A G 16: 65,827,958 E64G probably damaging Het
Vmn2r30 A G 7: 7,312,656 I726T possibly damaging Het
Vmn2r81 T C 10: 79,270,633 S482P possibly damaging Het
Wasf1 T G 10: 40,930,652 M97R possibly damaging Het
Wdr33 T A 18: 31,829,894 M98K probably benign Het
Wdr73 G A 7: 80,898,506 T95I probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
Peroration UTSW 17 34729399 critical splice donor site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7923:C4b UTSW 17 34742380 missense probably damaging 1.00
R7960:C4b UTSW 17 34741278 splice site probably null
R8420:C4b UTSW 17 34734539 missense probably damaging 0.97
R8467:C4b UTSW 17 34732813 missense possibly damaging 0.51
R8725:C4b UTSW 17 34734485 missense probably damaging 1.00
R8727:C4b UTSW 17 34734485 missense probably damaging 1.00
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAATGTGTTGCCCTCTCAGG -3'
(R):5'- TTCCAGAAGGCTGTCAGTGAG -3'

Sequencing Primer
(F):5'- GCCCTCTCAGGCGTCAC -3'
(R):5'- AGCACTGGGAGCCATGTCTTG -3'
Posted On2021-03-08