Incidental Mutation 'R8559:Rpgrip1'
ID660946
Institutional Source Beutler Lab
Gene Symbol Rpgrip1
Ensembl Gene ENSMUSG00000057132
Gene Nameretinitis pigmentosa GTPase regulator interacting protein 1
SynonymsA930002K18Rik, 4930505G06Rik, 4930401L23Rik, nmf247
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R8559 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location52110704-52163546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52149257 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 882 (S882P)
Ref Sequence ENSEMBL: ENSMUSP00000107230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111600] [ENSMUST00000111603] [ENSMUST00000180646] [ENSMUST00000181017] [ENSMUST00000181401]
Predicted Effect probably damaging
Transcript: ENSMUST00000111600
AA Change: S720P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107227
Gene: ENSMUSG00000057132
AA Change: S720P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 542 N/A INTRINSIC
C2 602 707 1.08e-2 SMART
coiled coil region 746 795 N/A INTRINSIC
Blast:C2 958 1086 1e-37 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000111603
AA Change: S882P
SMART Domains Protein: ENSMUSP00000107230
Gene: ENSMUSG00000057132
AA Change: S882P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 543 N/A INTRINSIC
Pfam:C2-C2_1 582 721 1.9e-49 PFAM
C2 764 869 7.3e-5 SMART
coiled coil region 910 999 N/A INTRINSIC
Blast:C2 1162 1290 2e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180500
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000180646
SMART Domains Protein: ENSMUSP00000137751
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181017
SMART Domains Protein: ENSMUSP00000137900
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Blast:C2 126 254 2e-41 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000181401
AA Change: S871P
SMART Domains Protein: ENSMUSP00000138027
Gene: ENSMUSG00000057132
AA Change: S871P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 547 N/A INTRINSIC
Pfam:DUF3250 605 710 2.8e-46 PFAM
C2 753 858 1.08e-2 SMART
coiled coil region 899 988 N/A INTRINSIC
Blast:C2 1151 1279 1e-37 BLAST
Predicted Effect silent
Transcript: ENSMUST00000181627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a photoreceptor protein that interacts with retinitis pigmentosa GTPase regulator protein and is a key component of cone and rod photoreceptor cells. Mutations in this gene lead to autosomal recessive congenital blindness. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in photoreceptor cell dysmorphology. By 3 months of age mutant animals show near complete loss of photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T A 10: 89,732,186 H19L probably benign Het
Adamts9 A T 6: 92,807,136 V1579E probably benign Het
Arhgap40 C T 2: 158,541,801 R435C probably damaging Het
Atp1a4 T C 1: 172,251,330 D207G probably damaging Het
Btaf1 A G 19: 36,986,873 N948S probably benign Het
Calcr G A 6: 3,692,603 P417L probably damaging Het
Cep250 T A 2: 155,992,736 S2194T probably damaging Het
Clcn6 C T 4: 148,026,575 V102M possibly damaging Het
Cog2 T C 8: 124,542,908 S396P probably benign Het
Col28a1 C A 6: 8,166,681 R265L unknown Het
Cpa6 C T 1: 10,408,349 W254* probably null Het
Crtc2 T A 3: 90,263,597 M659K possibly damaging Het
Ctgf CCCGCCAACCGC CCCGC 10: 24,596,068 probably null Het
Dnah7c A G 1: 46,725,139 Y3020C probably damaging Het
Dok2 C A 14: 70,777,528 H232N probably benign Het
Edem3 A G 1: 151,818,418 E834G probably benign Het
Elac2 T A 11: 64,981,676 probably null Het
Epx T A 11: 87,864,792 I689F probably damaging Het
Exd2 G A 12: 80,475,857 R30H probably benign Het
Gja1 T C 10: 56,388,208 L221P probably damaging Het
Gli3 T A 13: 15,660,132 L400Q probably damaging Het
Gm8439 T A 4: 120,600,811 W50R unknown Het
Greb1 T A 12: 16,696,435 D1278V probably damaging Het
Grin3a C A 4: 49,770,555 C739F probably damaging Het
Gucy2g C A 19: 55,210,354 V786F probably benign Het
Hmcn1 G A 1: 150,676,038 T2605I probably benign Het
Hmgxb3 T A 18: 61,155,419 T459S probably benign Het
Ift172 T C 5: 31,256,577 H1469R probably damaging Het
Il1rap A G 16: 26,712,134 I407V probably benign Het
Inppl1 G T 7: 101,829,627 S555* probably null Het
Krt8 T C 15: 102,001,544 M142V probably benign Het
Lrrk1 T A 7: 66,282,327 N1049I possibly damaging Het
Megf10 G A 18: 57,240,627 A166T probably damaging Het
Mei4 A T 9: 82,025,631 H338L probably benign Het
Mfsd2b T C 12: 4,871,471 T33A possibly damaging Het
Mgat3 A T 15: 80,212,169 Y399F probably damaging Het
Mtmr4 C T 11: 87,604,124 T414I probably damaging Het
Muc4 T C 16: 32,754,715 S1530P unknown Het
Myl4 T C 11: 104,584,104 V93A possibly damaging Het
N4bp2 T A 5: 65,825,285 S1627R possibly damaging Het
Narf T G 11: 121,250,432 probably null Het
Nbas A C 12: 13,352,808 I788L probably benign Het
Nlrc3 A G 16: 3,965,282 S104P probably benign Het
Olfr1047 A G 2: 86,228,644 V109A probably benign Het
Olfr1206 A T 2: 88,865,183 I193L probably benign Het
Olfr1240 T A 2: 89,440,184 I32F probably benign Het
Olfr127 A T 17: 37,903,828 Y94F probably benign Het
Ppp4r4 A T 12: 103,593,161 T534S probably benign Het
Prg3 A G 2: 84,989,336 E58G probably benign Het
Prima1 A G 12: 103,197,253 V153A possibly damaging Het
Rp1 A T 1: 4,349,561 Y443N probably damaging Het
Scn1a T A 2: 66,287,733 D412V probably damaging Het
Srcin1 T C 11: 97,537,149 T180A probably damaging Het
Suox A G 10: 128,670,731 L476P probably damaging Het
Tas2r104 T C 6: 131,685,425 Y107C probably damaging Het
Tubg2 T C 11: 101,156,784 V65A probably damaging Het
Ubn1 T C 16: 5,064,770 V365A possibly damaging Het
Vmn2r103 A G 17: 19,812,384 M807V probably benign Het
Vmn2r75 T A 7: 86,166,272 Y128F possibly damaging Het
Vps13b A T 15: 35,876,642 I2814F probably damaging Het
Vps54 T C 11: 21,264,815 Y108H probably damaging Het
Wdr6 T A 9: 108,575,394 E430V probably benign Het
Zfp619 T A 7: 39,537,135 V863E probably benign Het
Other mutations in Rpgrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Rpgrip1 APN 14 52150438 splice site probably null
IGL01016:Rpgrip1 APN 14 52145836 missense probably damaging 1.00
IGL01019:Rpgrip1 APN 14 52131176 missense possibly damaging 0.70
IGL01382:Rpgrip1 APN 14 52145477 missense possibly damaging 0.93
IGL01433:Rpgrip1 APN 14 52126377 missense probably damaging 1.00
IGL01528:Rpgrip1 APN 14 52112177 nonsense probably null
IGL01548:Rpgrip1 APN 14 52126271 splice site probably benign
IGL01652:Rpgrip1 APN 14 52145492 unclassified probably benign
IGL02040:Rpgrip1 APN 14 52121019 missense possibly damaging 0.86
IGL02113:Rpgrip1 APN 14 52133844 missense possibly damaging 0.85
IGL02121:Rpgrip1 APN 14 52147374 missense possibly damaging 0.89
IGL02185:Rpgrip1 APN 14 52112228 missense possibly damaging 0.72
IGL02234:Rpgrip1 APN 14 52131309 splice site probably benign
IGL02322:Rpgrip1 APN 14 52150042 missense possibly damaging 0.89
IGL02379:Rpgrip1 APN 14 52138888 missense possibly damaging 0.53
IGL02524:Rpgrip1 APN 14 52121054 missense probably benign 0.01
IGL02836:Rpgrip1 APN 14 52145257 splice site probably null
IGL03264:Rpgrip1 APN 14 52140652 missense possibly damaging 0.53
IGL03410:Rpgrip1 APN 14 52158366 unclassified probably benign
FR4976:Rpgrip1 UTSW 14 52149394 utr 3 prime probably benign
FR4976:Rpgrip1 UTSW 14 52149544 utr 3 prime probably benign
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0089:Rpgrip1 UTSW 14 52149384 utr 3 prime probably benign
R0498:Rpgrip1 UTSW 14 52131314 splice site probably benign
R0602:Rpgrip1 UTSW 14 52133856 missense possibly damaging 0.72
R0776:Rpgrip1 UTSW 14 52141169 missense possibly damaging 0.85
R1139:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
R1528:Rpgrip1 UTSW 14 52112224 missense probably benign 0.01
R1715:Rpgrip1 UTSW 14 52140691 missense possibly damaging 0.53
R1934:Rpgrip1 UTSW 14 52114644 missense possibly damaging 0.53
R2087:Rpgrip1 UTSW 14 52136622 splice site probably null
R2114:Rpgrip1 UTSW 14 52149567 missense probably benign 0.27
R3406:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R3835:Rpgrip1 UTSW 14 52147253 missense probably damaging 1.00
R4084:Rpgrip1 UTSW 14 52149351 missense possibly damaging 0.72
R4124:Rpgrip1 UTSW 14 52152324 splice site probably null
R4381:Rpgrip1 UTSW 14 52150449 missense possibly damaging 0.54
R4407:Rpgrip1 UTSW 14 52147399 missense probably damaging 1.00
R4520:Rpgrip1 UTSW 14 52152289 missense probably benign 0.08
R4904:Rpgrip1 UTSW 14 52121087 missense possibly damaging 0.86
R4904:Rpgrip1 UTSW 14 52160129 missense probably damaging 0.97
R5284:Rpgrip1 UTSW 14 52149276 missense probably damaging 1.00
R5342:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R5377:Rpgrip1 UTSW 14 52160195 missense possibly damaging 0.96
R5499:Rpgrip1 UTSW 14 52140585 missense probably benign 0.00
R5729:Rpgrip1 UTSW 14 52160160 missense probably benign 0.28
R5834:Rpgrip1 UTSW 14 52158382 missense probably damaging 0.99
R6157:Rpgrip1 UTSW 14 52112174 missense probably benign 0.00
R6455:Rpgrip1 UTSW 14 52141189 missense probably damaging 0.97
R6796:Rpgrip1 UTSW 14 52150012 missense probably damaging 1.00
R7065:Rpgrip1 UTSW 14 52141193 missense possibly damaging 0.96
R7173:Rpgrip1 UTSW 14 52112176 missense possibly damaging 0.59
R7302:Rpgrip1 UTSW 14 52149555 missense unknown
R7315:Rpgrip1 UTSW 14 52121001 missense not run
R7320:Rpgrip1 UTSW 14 52131216 missense possibly damaging 0.53
R7344:Rpgrip1 UTSW 14 52140659 missense probably damaging 0.98
R7459:Rpgrip1 UTSW 14 52140559 missense probably benign 0.18
R7797:Rpgrip1 UTSW 14 52133820 missense possibly damaging 0.53
R7852:Rpgrip1 UTSW 14 52145880 missense probably benign 0.01
R7916:Rpgrip1 UTSW 14 52131184 missense possibly damaging 0.53
R7990:Rpgrip1 UTSW 14 52129518 missense possibly damaging 0.53
R8041:Rpgrip1 UTSW 14 52119245 missense possibly damaging 0.53
R8344:Rpgrip1 UTSW 14 52150362 missense possibly damaging 0.62
R8403:Rpgrip1 UTSW 14 52152201 critical splice acceptor site probably null
R8679:Rpgrip1 UTSW 14 52159395 missense probably damaging 1.00
R8817:Rpgrip1 UTSW 14 52140599 missense probably benign 0.33
R8890:Rpgrip1 UTSW 14 52145044 missense possibly damaging 0.85
RF028:Rpgrip1 UTSW 14 52149398 nonsense probably null
RF034:Rpgrip1 UTSW 14 52149526 utr 3 prime probably benign
RF035:Rpgrip1 UTSW 14 52149393 utr 3 prime probably benign
RF036:Rpgrip1 UTSW 14 52149541 frame shift probably null
RF040:Rpgrip1 UTSW 14 52149537 frame shift probably null
RF043:Rpgrip1 UTSW 14 52149395 utr 3 prime probably benign
X0024:Rpgrip1 UTSW 14 52141208 missense possibly damaging 0.85
X0026:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GCAGAAATGCCTGTCTCCTG -3'
(R):5'- TCTTCCGTGAATGAGGCCTC -3'

Sequencing Primer
(F):5'- GAAATGCCTGTCTCCTGTCAGTATAG -3'
(R):5'- TGAATGAGGCCTCCAGGAC -3'
Posted On2021-03-08