Incidental Mutation 'R8559:Krt8'
ID 660950
Institutional Source Beutler Lab
Gene Symbol Krt8
Ensembl Gene ENSMUSG00000049382
Gene Name keratin 8
Synonyms Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8559 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 101996698-102004482 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102001544 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 142 (M142V)
Ref Sequence ENSEMBL: ENSMUSP00000023952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023952]
AlphaFold P11679
Predicted Effect probably benign
Transcript: ENSMUST00000023952
AA Change: M142V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: M142V

DomainStartEndE-ValueType
Pfam:Keratin_2_head 1 93 9.4e-18 PFAM
Filament 96 407 7.82e-188 SMART
low complexity region 421 438 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T A 10: 89,732,186 H19L probably benign Het
Adamts9 A T 6: 92,807,136 V1579E probably benign Het
Arhgap40 C T 2: 158,541,801 R435C probably damaging Het
Atp1a4 T C 1: 172,251,330 D207G probably damaging Het
Btaf1 A G 19: 36,986,873 N948S probably benign Het
Calcr G A 6: 3,692,603 P417L probably damaging Het
Cep250 T A 2: 155,992,736 S2194T probably damaging Het
Clcn6 C T 4: 148,026,575 V102M possibly damaging Het
Cog2 T C 8: 124,542,908 S396P probably benign Het
Col28a1 C A 6: 8,166,681 R265L unknown Het
Cpa6 C T 1: 10,408,349 W254* probably null Het
Crtc2 T A 3: 90,263,597 M659K possibly damaging Het
Ctgf CCCGCCAACCGC CCCGC 10: 24,596,068 probably null Het
Dnah7c A G 1: 46,725,139 Y3020C probably damaging Het
Dok2 C A 14: 70,777,528 H232N probably benign Het
Edem3 A G 1: 151,818,418 E834G probably benign Het
Elac2 T A 11: 64,981,676 probably null Het
Epx T A 11: 87,864,792 I689F probably damaging Het
Exd2 G A 12: 80,475,857 R30H probably benign Het
Gja1 T C 10: 56,388,208 L221P probably damaging Het
Gli3 T A 13: 15,660,132 L400Q probably damaging Het
Gm8439 T A 4: 120,600,811 W50R unknown Het
Greb1 T A 12: 16,696,435 D1278V probably damaging Het
Grin3a C A 4: 49,770,555 C739F probably damaging Het
Gucy2g C A 19: 55,210,354 V786F probably benign Het
Hmcn1 G A 1: 150,676,038 T2605I probably benign Het
Hmgxb3 T A 18: 61,155,419 T459S probably benign Het
Ift172 T C 5: 31,256,577 H1469R probably damaging Het
Il1rap A G 16: 26,712,134 I407V probably benign Het
Inppl1 G T 7: 101,829,627 S555* probably null Het
Lrrk1 T A 7: 66,282,327 N1049I possibly damaging Het
Megf10 G A 18: 57,240,627 A166T probably damaging Het
Mei4 A T 9: 82,025,631 H338L probably benign Het
Mfsd2b T C 12: 4,871,471 T33A possibly damaging Het
Mgat3 A T 15: 80,212,169 Y399F probably damaging Het
Mtmr4 C T 11: 87,604,124 T414I probably damaging Het
Muc4 T C 16: 32,754,715 S1530P unknown Het
Myl4 T C 11: 104,584,104 V93A possibly damaging Het
N4bp2 T A 5: 65,825,285 S1627R possibly damaging Het
Narf T G 11: 121,250,432 probably null Het
Nbas A C 12: 13,352,808 I788L probably benign Het
Nlrc3 A G 16: 3,965,282 S104P probably benign Het
Olfr1047 A G 2: 86,228,644 V109A probably benign Het
Olfr1206 A T 2: 88,865,183 I193L probably benign Het
Olfr1240 T A 2: 89,440,184 I32F probably benign Het
Olfr127 A T 17: 37,903,828 Y94F probably benign Het
Ppp4r4 A T 12: 103,593,161 T534S probably benign Het
Prg3 A G 2: 84,989,336 E58G probably benign Het
Prima1 A G 12: 103,197,253 V153A possibly damaging Het
Rp1 A T 1: 4,349,561 Y443N probably damaging Het
Rpgrip1 T C 14: 52,149,257 S882P unknown Het
Scn1a T A 2: 66,287,733 D412V probably damaging Het
Srcin1 T C 11: 97,537,149 T180A probably damaging Het
Suox A G 10: 128,670,731 L476P probably damaging Het
Tas2r104 T C 6: 131,685,425 Y107C probably damaging Het
Tubg2 T C 11: 101,156,784 V65A probably damaging Het
Ubn1 T C 16: 5,064,770 V365A possibly damaging Het
Vmn2r103 A G 17: 19,812,384 M807V probably benign Het
Vmn2r75 T A 7: 86,166,272 Y128F possibly damaging Het
Vps13b A T 15: 35,876,642 I2814F probably damaging Het
Vps54 T C 11: 21,264,815 Y108H probably damaging Het
Wdr6 T A 9: 108,575,394 E430V probably benign Het
Zfp619 T A 7: 39,537,135 V863E probably benign Het
Other mutations in Krt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Krt8 APN 15 101998025 missense probably benign
IGL01643:Krt8 APN 15 101997073 missense possibly damaging 0.64
IGL01966:Krt8 APN 15 101997670 missense probably benign 0.08
IGL02587:Krt8 APN 15 101998932 missense probably benign 0.04
IGL03088:Krt8 APN 15 102000587 missense possibly damaging 0.90
R0531:Krt8 UTSW 15 102001448 missense probably benign 0.12
R1451:Krt8 UTSW 15 101998829 missense possibly damaging 0.93
R2258:Krt8 UTSW 15 101998822 missense probably benign
R2348:Krt8 UTSW 15 101998865 missense probably benign 0.31
R2566:Krt8 UTSW 15 101998024 missense probably benign 0.03
R3796:Krt8 UTSW 15 101999442 missense probably benign 0.00
R4834:Krt8 UTSW 15 101998821 missense probably damaging 1.00
R4965:Krt8 UTSW 15 101996951 missense probably benign
R5212:Krt8 UTSW 15 101997967 missense possibly damaging 0.52
R5249:Krt8 UTSW 15 101998440 missense possibly damaging 0.69
R5419:Krt8 UTSW 15 102003902 missense probably damaging 0.98
R5778:Krt8 UTSW 15 102003939 missense probably damaging 0.99
R5997:Krt8 UTSW 15 102000594 missense possibly damaging 0.77
R6503:Krt8 UTSW 15 101997934 missense possibly damaging 0.66
R6683:Krt8 UTSW 15 101998004 missense probably benign
R6812:Krt8 UTSW 15 101997979 missense probably damaging 0.99
R6824:Krt8 UTSW 15 101998440 missense possibly damaging 0.50
R6875:Krt8 UTSW 15 101997908 missense probably benign 0.44
R7650:Krt8 UTSW 15 102004163 missense probably benign 0.07
R8047:Krt8 UTSW 15 102003971 missense probably damaging 0.99
R8826:Krt8 UTSW 15 102001435 missense possibly damaging 0.89
R9146:Krt8 UTSW 15 101998935 missense probably damaging 0.98
Z1177:Krt8 UTSW 15 101999435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGCAGAGGGTCACGAGAAC -3'
(R):5'- AGGACACTGCACTATTTCCCC -3'

Sequencing Primer
(F):5'- TCACGAGAACATAGGCCCGTG -3'
(R):5'- ATTTCCCCAGGACATACGTG -3'
Posted On 2021-03-08