Incidental Mutation 'R8559:Gucy2g'
ID660960
Institutional Source Beutler Lab
Gene Symbol Gucy2g
Ensembl Gene ENSMUSG00000055523
Gene Nameguanylate cyclase 2g
SynonymsGC-G, 2410077I05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8559 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location55198297-55241236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55210354 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 786 (V786F)
Ref Sequence ENSEMBL: ENSMUSP00000068253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069183]
Predicted Effect probably benign
Transcript: ENSMUST00000069183
AA Change: V786F

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523
AA Change: V786F

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:ANF_receptor 65 416 5.2e-36 PFAM
low complexity region 471 487 N/A INTRINSIC
Pfam:Pkinase 574 826 2e-26 PFAM
Pfam:Pkinase_Tyr 577 826 6e-35 PFAM
CYCc 865 1059 6.42e-96 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities and are protected against acute ischemia induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T A 10: 89,732,186 H19L probably benign Het
Adamts9 A T 6: 92,807,136 V1579E probably benign Het
Arhgap40 C T 2: 158,541,801 R435C probably damaging Het
Atp1a4 T C 1: 172,251,330 D207G probably damaging Het
Btaf1 A G 19: 36,986,873 N948S probably benign Het
Calcr G A 6: 3,692,603 P417L probably damaging Het
Cep250 T A 2: 155,992,736 S2194T probably damaging Het
Clcn6 C T 4: 148,026,575 V102M possibly damaging Het
Cog2 T C 8: 124,542,908 S396P probably benign Het
Col28a1 C A 6: 8,166,681 R265L unknown Het
Cpa6 C T 1: 10,408,349 W254* probably null Het
Crtc2 T A 3: 90,263,597 M659K possibly damaging Het
Ctgf CCCGCCAACCGC CCCGC 10: 24,596,068 probably null Het
Dnah7c A G 1: 46,725,139 Y3020C probably damaging Het
Dok2 C A 14: 70,777,528 H232N probably benign Het
Edem3 A G 1: 151,818,418 E834G probably benign Het
Elac2 T A 11: 64,981,676 probably null Het
Epx T A 11: 87,864,792 I689F probably damaging Het
Exd2 G A 12: 80,475,857 R30H probably benign Het
Gja1 T C 10: 56,388,208 L221P probably damaging Het
Gli3 T A 13: 15,660,132 L400Q probably damaging Het
Gm8439 T A 4: 120,600,811 W50R unknown Het
Greb1 T A 12: 16,696,435 D1278V probably damaging Het
Grin3a C A 4: 49,770,555 C739F probably damaging Het
Hmcn1 G A 1: 150,676,038 T2605I probably benign Het
Hmgxb3 T A 18: 61,155,419 T459S probably benign Het
Ift172 T C 5: 31,256,577 H1469R probably damaging Het
Il1rap A G 16: 26,712,134 I407V probably benign Het
Inppl1 G T 7: 101,829,627 S555* probably null Het
Krt8 T C 15: 102,001,544 M142V probably benign Het
Lrrk1 T A 7: 66,282,327 N1049I possibly damaging Het
Megf10 G A 18: 57,240,627 A166T probably damaging Het
Mei4 A T 9: 82,025,631 H338L probably benign Het
Mfsd2b T C 12: 4,871,471 T33A possibly damaging Het
Mgat3 A T 15: 80,212,169 Y399F probably damaging Het
Mtmr4 C T 11: 87,604,124 T414I probably damaging Het
Muc4 T C 16: 32,754,715 S1530P unknown Het
Myl4 T C 11: 104,584,104 V93A possibly damaging Het
N4bp2 T A 5: 65,825,285 S1627R possibly damaging Het
Narf T G 11: 121,250,432 probably null Het
Nbas A C 12: 13,352,808 I788L probably benign Het
Nlrc3 A G 16: 3,965,282 S104P probably benign Het
Olfr1047 A G 2: 86,228,644 V109A probably benign Het
Olfr1206 A T 2: 88,865,183 I193L probably benign Het
Olfr1240 T A 2: 89,440,184 I32F probably benign Het
Olfr127 A T 17: 37,903,828 Y94F probably benign Het
Ppp4r4 A T 12: 103,593,161 T534S probably benign Het
Prg3 A G 2: 84,989,336 E58G probably benign Het
Prima1 A G 12: 103,197,253 V153A possibly damaging Het
Rp1 A T 1: 4,349,561 Y443N probably damaging Het
Rpgrip1 T C 14: 52,149,257 S882P unknown Het
Scn1a T A 2: 66,287,733 D412V probably damaging Het
Srcin1 T C 11: 97,537,149 T180A probably damaging Het
Suox A G 10: 128,670,731 L476P probably damaging Het
Tas2r104 T C 6: 131,685,425 Y107C probably damaging Het
Tubg2 T C 11: 101,156,784 V65A probably damaging Het
Ubn1 T C 16: 5,064,770 V365A possibly damaging Het
Vmn2r103 A G 17: 19,812,384 M807V probably benign Het
Vmn2r75 T A 7: 86,166,272 Y128F possibly damaging Het
Vps13b A T 15: 35,876,642 I2814F probably damaging Het
Vps54 T C 11: 21,264,815 Y108H probably damaging Het
Wdr6 T A 9: 108,575,394 E430V probably benign Het
Zfp619 T A 7: 39,537,135 V863E probably benign Het
Other mutations in Gucy2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gucy2g APN 19 55233103 missense probably benign 0.01
IGL01954:Gucy2g APN 19 55198691 missense probably benign 0.01
IGL01969:Gucy2g APN 19 55227438 missense probably benign 0.00
IGL02164:Gucy2g APN 19 55238023 missense probably benign
IGL02534:Gucy2g APN 19 55241068 missense probably damaging 1.00
IGL02667:Gucy2g APN 19 55206177 missense possibly damaging 0.64
IGL02755:Gucy2g APN 19 55210354 missense probably benign 0.10
IGL03187:Gucy2g APN 19 55231052 missense possibly damaging 0.91
IGL03354:Gucy2g APN 19 55233080 missense possibly damaging 0.95
PIT4366001:Gucy2g UTSW 19 55237782 missense probably null 0.51
R0040:Gucy2g UTSW 19 55217302 missense possibly damaging 0.73
R0126:Gucy2g UTSW 19 55241166 missense probably benign
R0318:Gucy2g UTSW 19 55237798 missense probably benign 0.00
R0576:Gucy2g UTSW 19 55198770 missense probably damaging 1.00
R0604:Gucy2g UTSW 19 55203087 missense probably benign 0.00
R0962:Gucy2g UTSW 19 55210284 nonsense probably null
R1348:Gucy2g UTSW 19 55222906 missense possibly damaging 0.68
R1458:Gucy2g UTSW 19 55215036 splice site probably benign
R1693:Gucy2g UTSW 19 55222926 missense probably damaging 1.00
R1795:Gucy2g UTSW 19 55199541 missense probably damaging 1.00
R1804:Gucy2g UTSW 19 55210309 missense probably benign 0.34
R1830:Gucy2g UTSW 19 55222930 missense possibly damaging 0.94
R1902:Gucy2g UTSW 19 55210237 missense probably benign 0.20
R1927:Gucy2g UTSW 19 55237759 missense probably benign 0.02
R1969:Gucy2g UTSW 19 55222896 missense possibly damaging 0.90
R1969:Gucy2g UTSW 19 55233053 missense probably benign 0.42
R2071:Gucy2g UTSW 19 55222340 missense possibly damaging 0.72
R2842:Gucy2g UTSW 19 55240947 missense probably damaging 1.00
R2971:Gucy2g UTSW 19 55210276 missense probably damaging 1.00
R4202:Gucy2g UTSW 19 55229769 missense possibly damaging 0.96
R4405:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4407:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4614:Gucy2g UTSW 19 55202147 nonsense probably null
R4671:Gucy2g UTSW 19 55238068 missense probably damaging 1.00
R4684:Gucy2g UTSW 19 55206256 missense probably damaging 1.00
R4837:Gucy2g UTSW 19 55226053 missense probably benign
R4969:Gucy2g UTSW 19 55226013 missense probably benign
R5050:Gucy2g UTSW 19 55240935 missense probably benign 0.05
R5059:Gucy2g UTSW 19 55226071 missense probably benign 0.00
R5070:Gucy2g UTSW 19 55229787 missense probably damaging 0.98
R5288:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5384:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5386:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5497:Gucy2g UTSW 19 55198701 missense probably benign 0.00
R5531:Gucy2g UTSW 19 55241140 missense probably benign 0.24
R5536:Gucy2g UTSW 19 55237927 missense probably benign 0.05
R5679:Gucy2g UTSW 19 55231079 missense possibly damaging 0.87
R5715:Gucy2g UTSW 19 55233155 missense possibly damaging 0.93
R5941:Gucy2g UTSW 19 55215131 missense probably damaging 1.00
R6250:Gucy2g UTSW 19 55217424 missense probably damaging 0.99
R6288:Gucy2g UTSW 19 55227513 missense probably benign 0.01
R6378:Gucy2g UTSW 19 55240945 missense probably benign 0.00
R6605:Gucy2g UTSW 19 55241028 missense probably damaging 1.00
R7020:Gucy2g UTSW 19 55233050 missense probably damaging 0.98
R7064:Gucy2g UTSW 19 55210332 missense probably benign 0.01
R7078:Gucy2g UTSW 19 55241151 missense probably damaging 1.00
R7402:Gucy2g UTSW 19 55206293 missense probably damaging 1.00
R7539:Gucy2g UTSW 19 55203154 missense probably damaging 0.99
R7561:Gucy2g UTSW 19 55206340 missense probably benign 0.38
R7583:Gucy2g UTSW 19 55235615 missense probably damaging 1.00
R7804:Gucy2g UTSW 19 55228152 missense probably benign 0.02
R7880:Gucy2g UTSW 19 55206280 missense probably damaging 1.00
R8442:Gucy2g UTSW 19 55217401 missense probably benign 0.00
Z1177:Gucy2g UTSW 19 55210377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAAAATTATAGTCTGGGTGTGGC -3'
(R):5'- AGAACACCTGTGCACCTCTAG -3'

Sequencing Primer
(F):5'- ACATTGGAGAAGGAATAATCTACTGC -3'
(R):5'- GCACCTCTAGATCATCCTGAAATTC -3'
Posted On2021-03-08