Incidental Mutation 'R8560:Ahi1'
ID660996
Institutional Source Beutler Lab
Gene Symbol Ahi1
Ensembl Gene ENSMUSG00000019986
Gene NameAbelson helper integration site 1
Synonyms1700015F03Rik, Jouberin, D10Bwg0629e, Ahi-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R8560 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location20952547-21080429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20959915 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 49 (V49A)
Ref Sequence ENSEMBL: ENSMUSP00000101164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000213104]
Predicted Effect probably benign
Transcript: ENSMUST00000105525
AA Change: V49A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: V49A

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
WD40 448 490 4.3e-1 SMART
WD40 493 532 9.3e-9 SMART
WD40 537 576 2.48e-4 SMART
WD40 583 622 6.09e-4 SMART
WD40 641 678 1.9e2 SMART
WD40 684 721 3.98e0 SMART
WD40 724 769 9.51e1 SMART
SH3 905 961 2.15e-21 SMART
low complexity region 975 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213104
AA Change: V49A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,981,392 V819A unknown Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
BC017643 G T 11: 121,224,215 A154D probably damaging Het
Ccdc87 C T 19: 4,841,873 R798W probably damaging Het
Cd163 T C 6: 124,317,401 L506S possibly damaging Het
Chsy3 T C 18: 59,410,058 V756A possibly damaging Het
Cisd3 G T 11: 97,685,863 W5L possibly damaging Het
Coro1c A T 5: 113,846,188 H339Q probably damaging Het
D630045J12Rik T A 6: 38,149,714 I1454F probably damaging Het
Dab2ip T C 2: 35,713,132 S448P probably damaging Het
Dennd5a A G 7: 109,934,691 probably null Het
Depdc1a A G 3: 159,514,275 K139E probably damaging Het
Dock6 T C 9: 21,802,836 K1874R probably benign Het
Dst A G 1: 34,268,889 H4229R probably damaging Het
Esyt3 T C 9: 99,320,322 D512G probably damaging Het
Fastkd5 T A 2: 130,615,945 I242L probably benign Het
Foxo3 G A 10: 42,275,282 T51M possibly damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm14410 C A 2: 177,193,652 C273F probably damaging Het
Gucy1b1 G T 3: 82,035,378 P486T probably damaging Het
Hydin A G 8: 110,538,474 N2763S probably benign Het
Ifna2 C A 4: 88,683,265 W172L possibly damaging Het
Igkv6-29 T C 6: 70,138,667 N48D probably benign Het
Il17ra C A 6: 120,482,265 D792E possibly damaging Het
Kcnh5 G T 12: 74,976,605 A563E probably damaging Het
Klra4 C A 6: 130,065,272 V11L probably benign Het
Krt13 T C 11: 100,118,850 E368G possibly damaging Het
Lrpprc T A 17: 84,740,067 probably benign Het
Mal2 T C 15: 54,598,430 I107T probably benign Het
Mc4r T C 18: 66,859,095 I316V possibly damaging Het
Mdn1 T A 4: 32,743,830 V4022E probably benign Het
Med12l A G 3: 59,037,605 N84D probably damaging Het
Mx1 T G 16: 97,452,787 T298P probably damaging Het
Myh7 T C 14: 54,975,948 E1367G possibly damaging Het
Myh7b A G 2: 155,623,204 E660G possibly damaging Het
Nbeal1 T A 1: 60,235,157 N242K probably benign Het
Nsun5 A G 5: 135,375,889 T435A probably benign Het
Olfr115 C T 17: 37,610,058 S231N possibly damaging Het
Olfr1463 T C 19: 13,234,292 L14P possibly damaging Het
Olfr735 T A 14: 50,346,337 D4V probably benign Het
Pcdhb17 C T 18: 37,486,153 T332M possibly damaging Het
Pi4k2a C T 19: 42,100,712 Q171* probably null Het
Plb1 T C 5: 32,302,679 V421A possibly damaging Het
Prkag2 TTTTTTTTTTTTA T 5: 24,866,065 probably benign Het
Prlhr A G 19: 60,468,197 probably benign Het
Prpf8 T A 11: 75,491,774 C435* probably null Het
Rnf183 T A 4: 62,428,498 N21I probably damaging Het
Rnf41 T A 10: 128,438,353 C291* probably null Het
Shd T C 17: 55,971,616 S60P probably benign Het
Slc16a5 A G 11: 115,469,719 T243A probably benign Het
Slc33a1 A T 3: 63,943,352 I517N possibly damaging Het
Slc4a1 A C 11: 102,353,257 M682R possibly damaging Het
Sphk2 A T 7: 45,712,090 N245K probably damaging Het
Stx7 T C 10: 24,181,556 I160T possibly damaging Het
Thbs4 T C 13: 92,755,100 I836V probably damaging Het
Tmc5 A T 7: 118,669,291 N861Y probably damaging Het
Trappc5 T A 8: 3,679,303 W94R probably damaging Het
Trmt44 T C 5: 35,557,951 I673V probably benign Het
Ttn T C 2: 76,741,271 Y26426C probably damaging Het
Wdr81 C T 11: 75,445,434 G591R Het
Zfp236 G A 18: 82,646,215 R482W probably damaging Het
Zfp51 T A 17: 21,465,373 M750K probably benign Het
Other mutations in Ahi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ahi1 APN 10 20972141 missense probably damaging 1.00
IGL00914:Ahi1 APN 10 20984299 splice site probably null
IGL01075:Ahi1 APN 10 20987025 missense possibly damaging 0.80
IGL01094:Ahi1 APN 10 20972060 missense probably damaging 0.99
IGL01128:Ahi1 APN 10 21074433 missense probably benign
IGL01527:Ahi1 APN 10 20960085 splice site probably benign
IGL01821:Ahi1 APN 10 21041243 critical splice donor site probably null
IGL02159:Ahi1 APN 10 21058177 missense probably benign 0.13
IGL02176:Ahi1 APN 10 20970916 missense probably benign 0.00
IGL02200:Ahi1 APN 10 20981314 splice site probably benign
IGL02232:Ahi1 APN 10 20981375 missense probably damaging 1.00
IGL02305:Ahi1 APN 10 20970897 missense probably benign 0.00
IGL02323:Ahi1 APN 10 20972034 missense probably damaging 1.00
IGL02885:Ahi1 APN 10 21055113 missense possibly damaging 0.61
IGL02958:Ahi1 APN 10 20963799 missense probably damaging 1.00
IGL02971:Ahi1 APN 10 21000551 missense possibly damaging 0.93
IGL03109:Ahi1 APN 10 20970942 missense probably benign 0.00
IGL03192:Ahi1 APN 10 20965635 missense probably benign 0.00
IGL03377:Ahi1 APN 10 21018004 missense possibly damaging 0.51
arisen UTSW 10 21007768 missense possibly damaging 0.53
urspringt UTSW 10 20984393 missense probably damaging 1.00
P4717OSA:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
P4748:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
R0448:Ahi1 UTSW 10 20972075 missense probably damaging 1.00
R0559:Ahi1 UTSW 10 21000719 splice site probably benign
R0627:Ahi1 UTSW 10 20965522 missense probably benign 0.10
R0652:Ahi1 UTSW 10 20979461 missense probably damaging 1.00
R0690:Ahi1 UTSW 10 20970843 splice site probably benign
R1209:Ahi1 UTSW 10 20963730 missense probably damaging 0.98
R1364:Ahi1 UTSW 10 20972156 missense probably damaging 0.97
R1510:Ahi1 UTSW 10 20959800 missense probably benign 0.00
R1634:Ahi1 UTSW 10 20965693 missense probably damaging 1.00
R1789:Ahi1 UTSW 10 20963115 missense probably benign 0.18
R1818:Ahi1 UTSW 10 20988562 missense probably damaging 1.00
R2069:Ahi1 UTSW 10 20959996 missense probably damaging 0.98
R2148:Ahi1 UTSW 10 20970976 missense possibly damaging 0.64
R2566:Ahi1 UTSW 10 20970911 nonsense probably null
R2850:Ahi1 UTSW 10 21000593 missense probably benign 0.07
R2862:Ahi1 UTSW 10 20981408 missense probably damaging 0.99
R3969:Ahi1 UTSW 10 20959947 missense probably damaging 1.00
R4430:Ahi1 UTSW 10 20972078 missense probably damaging 1.00
R4496:Ahi1 UTSW 10 20965545 missense probably benign 0.07
R4755:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R4916:Ahi1 UTSW 10 20984404 missense probably damaging 1.00
R5216:Ahi1 UTSW 10 20960076 missense probably benign 0.00
R5223:Ahi1 UTSW 10 20970919 missense possibly damaging 0.79
R5224:Ahi1 UTSW 10 20987022 missense probably damaging 1.00
R5604:Ahi1 UTSW 10 20987005 missense probably damaging 1.00
R5665:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R5704:Ahi1 UTSW 10 21074427 missense probably benign
R5769:Ahi1 UTSW 10 20960082 critical splice donor site probably null
R5899:Ahi1 UTSW 10 21000566 missense probably benign 0.06
R5936:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R5969:Ahi1 UTSW 10 20984393 missense probably damaging 1.00
R6066:Ahi1 UTSW 10 20959926 missense possibly damaging 0.84
R6122:Ahi1 UTSW 10 21058165 missense probably benign 0.26
R6135:Ahi1 UTSW 10 20969121 missense probably benign 0.01
R6240:Ahi1 UTSW 10 20977081 missense probably damaging 1.00
R6387:Ahi1 UTSW 10 20969043 missense probably damaging 1.00
R6395:Ahi1 UTSW 10 20979592 missense possibly damaging 0.49
R6406:Ahi1 UTSW 10 20977049 missense probably damaging 1.00
R6440:Ahi1 UTSW 10 20960082 critical splice donor site probably benign
R6558:Ahi1 UTSW 10 20963673 missense probably damaging 1.00
R6744:Ahi1 UTSW 10 20965567 missense probably damaging 1.00
R6755:Ahi1 UTSW 10 21017913 missense probably damaging 0.98
R6927:Ahi1 UTSW 10 21055069 missense probably damaging 1.00
R6932:Ahi1 UTSW 10 20963691 missense probably benign 0.02
R6967:Ahi1 UTSW 10 20988625 missense probably damaging 0.98
R7168:Ahi1 UTSW 10 21017932 missense probably benign 0.01
R7169:Ahi1 UTSW 10 21055019 missense probably damaging 1.00
R7327:Ahi1 UTSW 10 20987077 missense probably damaging 0.99
R7351:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R7489:Ahi1 UTSW 10 20963750 missense probably benign 0.35
R7680:Ahi1 UTSW 10 21007768 missense possibly damaging 0.53
R7878:Ahi1 UTSW 10 20981431 critical splice donor site probably null
R7999:Ahi1 UTSW 10 20965681 missense probably benign 0.31
R8219:Ahi1 UTSW 10 21074436 missense probably benign 0.00
R8248:Ahi1 UTSW 10 20972092 missense probably benign 0.04
X0024:Ahi1 UTSW 10 21000592 missense possibly damaging 0.69
Z1177:Ahi1 UTSW 10 21041007 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTGAGCAGCACGTGAAGATTC -3'
(R):5'- CCTTGACTCAGGCTTAGTGG -3'

Sequencing Primer
(F):5'- GACAATGTTAGTGTAGAGCCATAC -3'
(R):5'- ACTCAGGCTTAGTGGGCACTG -3'
Posted On2021-03-08