Incidental Mutation 'R8560:Kcnh5'
ID661007
Institutional Source Beutler Lab
Gene Symbol Kcnh5
Ensembl Gene ENSMUSG00000034402
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 5
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8560 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location74897220-75177332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74976605 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 563 (A563E)
Ref Sequence ENSEMBL: ENSMUSP00000046864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042299]
Predicted Effect probably damaging
Transcript: ENSMUST00000042299
AA Change: A563E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046864
Gene: ENSMUSG00000034402
AA Change: A563E

DomainStartEndE-ValueType
PAS 14 86 8.97e0 SMART
PAC 92 134 6.64e-7 SMART
Pfam:Ion_trans 214 479 1.2e-37 PFAM
Pfam:Ion_trans_2 390 473 5e-14 PFAM
cNMP 550 668 2.48e-15 SMART
low complexity region 710 717 N/A INTRINSIC
coiled coil region 907 944 N/A INTRINSIC
low complexity region 953 968 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of voltage-gated potassium channels. Members of this family have diverse functions, including regulating neurotransmitter and hormone release, cardiac function, and cell volume. This protein is an outward-rectifying, noninactivating channel. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted gene disruption display thigmotaxis and abnormal startle reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,981,392 V819A unknown Het
Ahi1 T C 10: 20,959,915 V49A probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
BC017643 G T 11: 121,224,215 A154D probably damaging Het
Ccdc87 C T 19: 4,841,873 R798W probably damaging Het
Cd163 T C 6: 124,317,401 L506S possibly damaging Het
Chsy3 T C 18: 59,410,058 V756A possibly damaging Het
Cisd3 G T 11: 97,685,863 W5L possibly damaging Het
Coro1c A T 5: 113,846,188 H339Q probably damaging Het
D630045J12Rik T A 6: 38,149,714 I1454F probably damaging Het
Dab2ip T C 2: 35,713,132 S448P probably damaging Het
Dennd5a A G 7: 109,934,691 probably null Het
Depdc1a A G 3: 159,514,275 K139E probably damaging Het
Dock6 T C 9: 21,802,836 K1874R probably benign Het
Dst A G 1: 34,268,889 H4229R probably damaging Het
Esyt3 T C 9: 99,320,322 D512G probably damaging Het
Fastkd5 T A 2: 130,615,945 I242L probably benign Het
Foxo3 G A 10: 42,275,282 T51M possibly damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm14410 C A 2: 177,193,652 C273F probably damaging Het
Gucy1b1 G T 3: 82,035,378 P486T probably damaging Het
Hydin A G 8: 110,538,474 N2763S probably benign Het
Ifna2 C A 4: 88,683,265 W172L possibly damaging Het
Igkv6-29 T C 6: 70,138,667 N48D probably benign Het
Il17ra C A 6: 120,482,265 D792E possibly damaging Het
Klra4 C A 6: 130,065,272 V11L probably benign Het
Krt13 T C 11: 100,118,850 E368G possibly damaging Het
Lrpprc T A 17: 84,740,067 probably benign Het
Mal2 T C 15: 54,598,430 I107T probably benign Het
Mc4r T C 18: 66,859,095 I316V possibly damaging Het
Mdn1 T A 4: 32,743,830 V4022E probably benign Het
Med12l A G 3: 59,037,605 N84D probably damaging Het
Mx1 T G 16: 97,452,787 T298P probably damaging Het
Myh7 T C 14: 54,975,948 E1367G possibly damaging Het
Myh7b A G 2: 155,623,204 E660G possibly damaging Het
Nbeal1 T A 1: 60,235,157 N242K probably benign Het
Nsun5 A G 5: 135,375,889 T435A probably benign Het
Olfr115 C T 17: 37,610,058 S231N possibly damaging Het
Olfr1463 T C 19: 13,234,292 L14P possibly damaging Het
Olfr735 T A 14: 50,346,337 D4V probably benign Het
Pcdhb17 C T 18: 37,486,153 T332M possibly damaging Het
Pi4k2a C T 19: 42,100,712 Q171* probably null Het
Plb1 T C 5: 32,302,679 V421A possibly damaging Het
Prkag2 TTTTTTTTTTTTA T 5: 24,866,065 probably benign Het
Prlhr A G 19: 60,468,197 probably benign Het
Prpf8 T A 11: 75,491,774 C435* probably null Het
Rnf183 T A 4: 62,428,498 N21I probably damaging Het
Rnf41 T A 10: 128,438,353 C291* probably null Het
Shd T C 17: 55,971,616 S60P probably benign Het
Slc16a5 A G 11: 115,469,719 T243A probably benign Het
Slc33a1 A T 3: 63,943,352 I517N possibly damaging Het
Slc4a1 A C 11: 102,353,257 M682R possibly damaging Het
Sphk2 A T 7: 45,712,090 N245K probably damaging Het
Stx7 T C 10: 24,181,556 I160T possibly damaging Het
Thbs4 T C 13: 92,755,100 I836V probably damaging Het
Tmc5 A T 7: 118,669,291 N861Y probably damaging Het
Trappc5 T A 8: 3,679,303 W94R probably damaging Het
Trmt44 T C 5: 35,557,951 I673V probably benign Het
Ttn T C 2: 76,741,271 Y26426C probably damaging Het
Wdr81 C T 11: 75,445,434 G591R Het
Zfp236 G A 18: 82,646,215 R482W probably damaging Het
Zfp51 T A 17: 21,465,373 M750K probably benign Het
Other mutations in Kcnh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kcnh5 APN 12 74897796 missense probably benign 0.00
IGL00675:Kcnh5 APN 12 75114189 critical splice donor site probably null
IGL00688:Kcnh5 APN 12 74898397 missense probably benign 0.01
IGL00721:Kcnh5 APN 12 75007676 missense probably benign 0.32
IGL00793:Kcnh5 APN 12 75114346 missense probably damaging 0.99
IGL00802:Kcnh5 APN 12 75007625 missense possibly damaging 0.62
IGL00920:Kcnh5 APN 12 74976493 missense probably damaging 1.00
IGL01595:Kcnh5 APN 12 74898327 missense probably benign 0.05
IGL01642:Kcnh5 APN 12 74965169 missense probably damaging 0.98
IGL01675:Kcnh5 APN 12 75114500 nonsense probably null
IGL01733:Kcnh5 APN 12 74965192 missense probably benign 0.02
IGL02006:Kcnh5 APN 12 74897548 missense probably damaging 0.99
IGL02075:Kcnh5 APN 12 75087605 missense probably benign 0.00
IGL02148:Kcnh5 APN 12 74897652 missense possibly damaging 0.86
IGL02155:Kcnh5 APN 12 75176538 utr 5 prime probably benign
IGL02304:Kcnh5 APN 12 74976697 missense probably benign 0.01
IGL02957:Kcnh5 APN 12 75007665 missense probably benign 0.01
R0305:Kcnh5 UTSW 12 75114397 missense probably benign 0.00
R0470:Kcnh5 UTSW 12 75114414 missense probably benign 0.22
R0553:Kcnh5 UTSW 12 75137673 missense probably benign 0.00
R0557:Kcnh5 UTSW 12 75114549 missense probably damaging 1.00
R0590:Kcnh5 UTSW 12 74965261 missense probably damaging 1.00
R0697:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R0699:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R1512:Kcnh5 UTSW 12 75119937 missense probably benign
R1728:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1739:Kcnh5 UTSW 12 75114229 missense probably damaging 1.00
R1784:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1956:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R1957:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R2155:Kcnh5 UTSW 12 74898456 critical splice acceptor site probably null
R2185:Kcnh5 UTSW 12 75130931 missense possibly damaging 0.95
R2237:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2239:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2483:Kcnh5 UTSW 12 75114471 missense probably damaging 1.00
R2655:Kcnh5 UTSW 12 75114540 missense probably damaging 1.00
R3767:Kcnh5 UTSW 12 75087576 missense possibly damaging 0.81
R3835:Kcnh5 UTSW 12 74898270 missense probably benign
R4681:Kcnh5 UTSW 12 75007623 missense probably benign 0.00
R4728:Kcnh5 UTSW 12 75007781 missense probably damaging 1.00
R4965:Kcnh5 UTSW 12 74965151 missense probably benign 0.11
R5127:Kcnh5 UTSW 12 74898084 missense probably benign 0.17
R5267:Kcnh5 UTSW 12 75087416 missense probably damaging 0.98
R5535:Kcnh5 UTSW 12 75130907 missense possibly damaging 0.76
R5590:Kcnh5 UTSW 12 74976689 missense probably benign 0.05
R5684:Kcnh5 UTSW 12 75137649 missense probably damaging 1.00
R5747:Kcnh5 UTSW 12 74898420 missense probably benign 0.04
R6123:Kcnh5 UTSW 12 75087591 missense probably benign 0.01
R6545:Kcnh5 UTSW 12 75007658 missense probably damaging 1.00
R6662:Kcnh5 UTSW 12 75007611 missense probably damaging 1.00
R7117:Kcnh5 UTSW 12 75114445 missense possibly damaging 0.87
R7161:Kcnh5 UTSW 12 74897709 missense probably benign 0.10
R7437:Kcnh5 UTSW 12 75137643 critical splice donor site probably null
R7557:Kcnh5 UTSW 12 75007625 missense possibly damaging 0.62
R7566:Kcnh5 UTSW 12 75114392 nonsense probably null
R7591:Kcnh5 UTSW 12 75007767 missense probably benign 0.24
R7781:Kcnh5 UTSW 12 74976681 missense probably damaging 0.99
R7816:Kcnh5 UTSW 12 74976683 missense probably damaging 1.00
R8152:Kcnh5 UTSW 12 74897859 missense possibly damaging 0.68
R8390:Kcnh5 UTSW 12 75087758 missense probably damaging 1.00
Z1088:Kcnh5 UTSW 12 74897761 missense probably benign 0.00
Z1088:Kcnh5 UTSW 12 74965295 missense possibly damaging 0.78
Z1177:Kcnh5 UTSW 12 75007797 missense possibly damaging 0.90
Z1177:Kcnh5 UTSW 12 75114522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGGAAGCTAAAACTCCAGGAC -3'
(R):5'- TCAATCAGCATTTGTGGCATC -3'

Sequencing Primer
(F):5'- GACAGTGCCCCATTTGTCATTGAG -3'
(R):5'- AATCAGCATTTGTGGCATCTTTTTC -3'
Posted On2021-03-08