Incidental Mutation 'R8560:Olfr735'
ID661009
Institutional Source Beutler Lab
Gene Symbol Olfr735
Ensembl Gene ENSMUSG00000046210
Gene Nameolfactory receptor 735
SynonymsMOR243-1, GA_x6K02T2PMLR-6042130-6041183
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8560 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50342612-50348872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50346337 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 4 (D4V)
Ref Sequence ENSEMBL: ENSMUSP00000153148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049729] [ENSMUST00000216634]
Predicted Effect probably benign
Transcript: ENSMUST00000049729
AA Change: D35V

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056851
Gene: ENSMUSG00000046210
AA Change: D35V

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:7tm_4 70 345 1.6e-49 PFAM
Pfam:7tm_1 80 345 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216634
AA Change: D4V

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,981,392 V819A unknown Het
Ahi1 T C 10: 20,959,915 V49A probably benign Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
BC017643 G T 11: 121,224,215 A154D probably damaging Het
Ccdc87 C T 19: 4,841,873 R798W probably damaging Het
Cd163 T C 6: 124,317,401 L506S possibly damaging Het
Chsy3 T C 18: 59,410,058 V756A possibly damaging Het
Cisd3 G T 11: 97,685,863 W5L possibly damaging Het
Coro1c A T 5: 113,846,188 H339Q probably damaging Het
D630045J12Rik T A 6: 38,149,714 I1454F probably damaging Het
Dab2ip T C 2: 35,713,132 S448P probably damaging Het
Dennd5a A G 7: 109,934,691 probably null Het
Depdc1a A G 3: 159,514,275 K139E probably damaging Het
Dock6 T C 9: 21,802,836 K1874R probably benign Het
Dst A G 1: 34,268,889 H4229R probably damaging Het
Esyt3 T C 9: 99,320,322 D512G probably damaging Het
Fastkd5 T A 2: 130,615,945 I242L probably benign Het
Foxo3 G A 10: 42,275,282 T51M possibly damaging Het
Gcfc2 T C 6: 81,923,882 V59A possibly damaging Het
Gm14410 C A 2: 177,193,652 C273F probably damaging Het
Gucy1b1 G T 3: 82,035,378 P486T probably damaging Het
Hydin A G 8: 110,538,474 N2763S probably benign Het
Ifna2 C A 4: 88,683,265 W172L possibly damaging Het
Igkv6-29 T C 6: 70,138,667 N48D probably benign Het
Il17ra C A 6: 120,482,265 D792E possibly damaging Het
Kcnh5 G T 12: 74,976,605 A563E probably damaging Het
Klra4 C A 6: 130,065,272 V11L probably benign Het
Krt13 T C 11: 100,118,850 E368G possibly damaging Het
Lrpprc T A 17: 84,740,067 probably benign Het
Mal2 T C 15: 54,598,430 I107T probably benign Het
Mc4r T C 18: 66,859,095 I316V possibly damaging Het
Mdn1 T A 4: 32,743,830 V4022E probably benign Het
Med12l A G 3: 59,037,605 N84D probably damaging Het
Mx1 T G 16: 97,452,787 T298P probably damaging Het
Myh7 T C 14: 54,975,948 E1367G possibly damaging Het
Myh7b A G 2: 155,623,204 E660G possibly damaging Het
Nbeal1 T A 1: 60,235,157 N242K probably benign Het
Nsun5 A G 5: 135,375,889 T435A probably benign Het
Olfr115 C T 17: 37,610,058 S231N possibly damaging Het
Olfr1463 T C 19: 13,234,292 L14P possibly damaging Het
Pcdhb17 C T 18: 37,486,153 T332M possibly damaging Het
Pi4k2a C T 19: 42,100,712 Q171* probably null Het
Plb1 T C 5: 32,302,679 V421A possibly damaging Het
Prkag2 TTTTTTTTTTTTA T 5: 24,866,065 probably benign Het
Prlhr A G 19: 60,468,197 probably benign Het
Prpf8 T A 11: 75,491,774 C435* probably null Het
Rnf183 T A 4: 62,428,498 N21I probably damaging Het
Rnf41 T A 10: 128,438,353 C291* probably null Het
Shd T C 17: 55,971,616 S60P probably benign Het
Slc16a5 A G 11: 115,469,719 T243A probably benign Het
Slc33a1 A T 3: 63,943,352 I517N possibly damaging Het
Slc4a1 A C 11: 102,353,257 M682R possibly damaging Het
Sphk2 A T 7: 45,712,090 N245K probably damaging Het
Stx7 T C 10: 24,181,556 I160T possibly damaging Het
Thbs4 T C 13: 92,755,100 I836V probably damaging Het
Tmc5 A T 7: 118,669,291 N861Y probably damaging Het
Trappc5 T A 8: 3,679,303 W94R probably damaging Het
Trmt44 T C 5: 35,557,951 I673V probably benign Het
Ttn T C 2: 76,741,271 Y26426C probably damaging Het
Wdr81 C T 11: 75,445,434 G591R Het
Zfp236 G A 18: 82,646,215 R482W probably damaging Het
Zfp51 T A 17: 21,465,373 M750K probably benign Het
Other mutations in Olfr735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr735 APN 14 50345614 missense probably damaging 0.99
IGL01655:Olfr735 APN 14 50346184 missense probably benign 0.01
IGL02838:Olfr735 APN 14 50345855 missense probably damaging 1.00
IGL02874:Olfr735 APN 14 50346126 missense probably damaging 1.00
R0609:Olfr735 UTSW 14 50345926 missense probably damaging 1.00
R0724:Olfr735 UTSW 14 50345917 missense possibly damaging 0.89
R0839:Olfr735 UTSW 14 50346088 missense probably damaging 0.98
R1766:Olfr735 UTSW 14 50346220 missense probably damaging 1.00
R1799:Olfr735 UTSW 14 50346080 missense probably benign 0.32
R4934:Olfr735 UTSW 14 50345888 missense probably damaging 1.00
R5753:Olfr735 UTSW 14 50345588 missense probably damaging 0.96
R5996:Olfr735 UTSW 14 50345512 missense possibly damaging 0.89
R6555:Olfr735 UTSW 14 50345846 nonsense probably null
R6736:Olfr735 UTSW 14 50345448 missense probably damaging 1.00
R7841:Olfr735 UTSW 14 50345828 missense probably benign 0.09
R7922:Olfr735 UTSW 14 50346415 missense probably benign 0.03
R8190:Olfr735 UTSW 14 50345722 missense probably damaging 0.99
R8308:Olfr735 UTSW 14 50345465 missense probably benign 0.06
X0019:Olfr735 UTSW 14 50345806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCAGGCAAAGGTCAATG -3'
(R):5'- GGCGGGTAACTACTCTTTTGTAGAAC -3'

Sequencing Primer
(F):5'- CTTAGAAAATAGTACATGGGTGACTG -3'
(R):5'- ACTCTTTTGTAGAACATAGCAGTTC -3'
Posted On2021-03-08