Incidental Mutation 'R8669:Slc16a14'
ID 661026
Institutional Source Beutler Lab
Gene Symbol Slc16a14
Ensembl Gene ENSMUSG00000026220
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 14
Synonyms 1110004H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8669 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 84905898-84935134 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84922884 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 127 (S127P)
Ref Sequence ENSEMBL: ENSMUSP00000027422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027422]
AlphaFold Q8K1C7
Predicted Effect probably benign
Transcript: ENSMUST00000027422
AA Change: S127P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000027422
Gene: ENSMUSG00000026220
AA Change: S127P

DomainStartEndE-ValueType
Pfam:MFS_1 42 427 6.7e-42 PFAM
Pfam:MFS_1 419 509 7.9e-10 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,902,460 S305T probably benign Het
Ankrd42 A G 7: 92,619,673 V154A possibly damaging Het
Apc2 C T 10: 80,313,657 T1515I probably damaging Het
Blzf1 T A 1: 164,302,544 N80Y possibly damaging Het
Cacna2d1 T C 5: 15,935,015 M1T probably null Het
Ccdc125 T C 13: 100,696,175 L420P probably damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cdc20b C T 13: 113,071,926 P219S possibly damaging Het
Cep89 A G 7: 35,429,177 D585G probably benign Het
Crnn A T 3: 93,148,989 R361* probably null Het
Defb5 A G 8: 19,250,745 I38V probably benign Het
Defb8 A G 8: 19,445,957 V29A probably benign Het
Dgkh A G 14: 78,725,019 V24A probably benign Het
Dhrs13 G C 11: 78,032,666 R70P possibly damaging Het
Dnah12 A T 14: 26,830,625 probably benign Het
Dsg2 A G 18: 20,590,075 N386S probably damaging Het
Dyrk1a G T 16: 94,663,791 R77L probably damaging Het
Fbxw19 G T 9: 109,484,414 L239I probably benign Het
Gal3st2b A T 1: 93,941,042 I332L possibly damaging Het
Gcnt1 T G 19: 17,329,779 K194T probably benign Het
Gm21731 C A 13: 120,240,802 P45T probably benign Het
Gm7298 T C 6: 121,765,043 W475R probably benign Het
Gpatch1 C A 7: 35,291,779 W613C probably damaging Het
Gulp1 T A 1: 44,766,110 S120T probably benign Het
Ift122 C A 6: 115,923,291 Q946K probably damaging Het
Itpr1 T A 6: 108,393,967 L1065H probably damaging Het
Kcnq5 T C 1: 21,405,826 D579G probably damaging Het
Klhl40 T A 9: 121,778,022 S83T probably benign Het
Krt19 T C 11: 100,141,167 K320E probably damaging Het
Krt83 C A 15: 101,487,896 V273L probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrp1b A G 2: 41,282,035 probably null Het
Lrrk1 G A 7: 66,262,596 L1739F probably benign Het
Mthfr A G 4: 148,051,477 N336D probably benign Het
Myo6 T G 9: 80,266,249 L557R unknown Het
Naip2 T C 13: 100,188,969 S144G probably benign Het
Nfatc1 T C 18: 80,682,191 K453E probably damaging Het
Olfr598 A T 7: 103,329,074 D196V probably benign Het
Osm A T 11: 4,239,665 I150L probably benign Het
Phtf1 T A 3: 104,003,476 N639K probably benign Het
Prpf40b T A 15: 99,303,347 M1K probably null Het
Rhbdl3 G A 11: 80,353,513 V349M probably damaging Het
Senp7 T C 16: 56,165,952 S582P probably damaging Het
Slc22a21 C T 11: 53,979,817 W14* probably null Het
Slc6a18 T A 13: 73,664,311 E553D probably benign Het
Speer4a T G 5: 26,038,238 N83T probably damaging Het
Svep1 T A 4: 58,070,119 S2556C possibly damaging Het
Tc2n T C 12: 101,694,592 N127S probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Thra T C 11: 98,763,650 V282A possibly damaging Het
Tmem161b A T 13: 84,272,169 probably null Het
Tmem218 C T 9: 37,222,519 A85V probably benign Het
Txnip T C 3: 96,558,936 Y100H probably damaging Het
Unc5c A G 3: 141,803,943 D728G possibly damaging Het
Zfp462 T A 4: 55,051,313 I2262K probably damaging Het
Zfp804a A T 2: 82,257,762 D645V probably damaging Het
Other mutations in Slc16a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slc16a14 APN 1 84922871 missense probably damaging 0.99
IGL01563:Slc16a14 APN 1 84912187 splice site probably benign
R0315:Slc16a14 UTSW 1 84912496 missense possibly damaging 0.46
R0380:Slc16a14 UTSW 1 84929530 missense possibly damaging 0.72
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1837:Slc16a14 UTSW 1 84912399 missense probably benign 0.02
R2149:Slc16a14 UTSW 1 84907399 missense probably damaging 1.00
R2293:Slc16a14 UTSW 1 84912843 missense probably benign
R3790:Slc16a14 UTSW 1 84929280 unclassified probably benign
R4016:Slc16a14 UTSW 1 84912507 nonsense probably null
R4596:Slc16a14 UTSW 1 84929357 missense probably damaging 1.00
R4637:Slc16a14 UTSW 1 84907282 missense possibly damaging 0.86
R4723:Slc16a14 UTSW 1 84913020 missense probably damaging 1.00
R5137:Slc16a14 UTSW 1 84912597 missense probably damaging 1.00
R5262:Slc16a14 UTSW 1 84912891 missense probably benign 0.00
R5410:Slc16a14 UTSW 1 84907424 missense probably damaging 0.98
R5927:Slc16a14 UTSW 1 84912267 missense possibly damaging 0.91
R5968:Slc16a14 UTSW 1 84912505 missense possibly damaging 0.70
R6052:Slc16a14 UTSW 1 84912709 missense possibly damaging 0.75
R6264:Slc16a14 UTSW 1 84907409 missense probably benign 0.30
R6290:Slc16a14 UTSW 1 84907385 missense probably benign 0.10
R7383:Slc16a14 UTSW 1 84912571 missense probably damaging 1.00
R7390:Slc16a14 UTSW 1 84929466 missense probably benign 0.25
R7535:Slc16a14 UTSW 1 84913122 missense probably damaging 1.00
R8326:Slc16a14 UTSW 1 84912345 missense possibly damaging 0.94
R8784:Slc16a14 UTSW 1 84913063 missense probably benign 0.01
R9409:Slc16a14 UTSW 1 84929395 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATTATAGAATCGCAGGCACATG -3'
(R):5'- TTGGTCTCCTTTGAGCAGCC -3'

Sequencing Primer
(F):5'- AATGAAACCTGGGTCCTCTG -3'
(R):5'- TCCTTTGAGCAGCCCTGGTG -3'
Posted On 2021-03-08