Incidental Mutation 'R8669:Unc5c'
ID661034
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Nameunc-5 netrin receptor C
SynonymsB130051O18Rik, Unc5h3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8669 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location141465216-141834924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141803943 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 728 (D728G)
Ref Sequence ENSEMBL: ENSMUSP00000074758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075282
AA Change: D728G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: D728G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106236
AA Change: D709G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: D709G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130636
AA Change: D654G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: D654G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142762
AA Change: D728G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: D728G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,902,460 S305T probably benign Het
Ankrd42 A G 7: 92,619,673 V154A possibly damaging Het
Apc2 C T 10: 80,313,657 T1515I probably damaging Het
Blzf1 T A 1: 164,302,544 N80Y possibly damaging Het
Cacna2d1 T C 5: 15,935,015 M1T probably null Het
Ccdc125 T C 13: 100,696,175 L420P probably damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cdc20b C T 13: 113,071,926 P219S possibly damaging Het
Cep89 A G 7: 35,429,177 D585G probably benign Het
Crnn A T 3: 93,148,989 R361* probably null Het
Defb5 A G 8: 19,250,745 I38V probably benign Het
Defb8 A G 8: 19,445,957 V29A probably benign Het
Dgkh A G 14: 78,725,019 V24A probably benign Het
Dhrs13 G C 11: 78,032,666 R70P possibly damaging Het
Dsg2 A G 18: 20,590,075 N386S probably damaging Het
Dyrk1a G T 16: 94,663,791 R77L probably damaging Het
Fbxw19 G T 9: 109,484,414 L239I probably benign Het
Gal3st2b A T 1: 93,941,042 I332L possibly damaging Het
Gcnt1 T G 19: 17,329,779 K194T probably benign Het
Gm21731 C A 13: 120,240,802 P45T probably benign Het
Gm7298 T C 6: 121,765,043 W475R probably benign Het
Gpatch1 C A 7: 35,291,779 W613C probably damaging Het
Gulp1 T A 1: 44,766,110 S120T probably benign Het
Ift122 C A 6: 115,923,291 Q946K probably damaging Het
Itpr1 T A 6: 108,393,967 L1065H probably damaging Het
Kcnq5 T C 1: 21,405,826 D579G probably damaging Het
Klhl40 T A 9: 121,778,022 S83T probably benign Het
Krt19 T C 11: 100,141,167 K320E probably damaging Het
Krt83 C A 15: 101,487,896 V273L probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrp1b A G 2: 41,282,035 probably null Het
Lrrk1 G A 7: 66,262,596 L1739F probably benign Het
Mthfr A G 4: 148,051,477 N336D probably benign Het
Myo6 T G 9: 80,266,249 L557R unknown Het
Naip2 T C 13: 100,188,969 S144G probably benign Het
Nfatc1 T C 18: 80,682,191 K453E probably damaging Het
Olfr598 A T 7: 103,329,074 D196V probably benign Het
Osm A T 11: 4,239,665 I150L probably benign Het
Phtf1 T A 3: 104,003,476 N639K probably benign Het
Prpf40b T A 15: 99,303,347 M1K probably null Het
Rhbdl3 G A 11: 80,353,513 V349M probably damaging Het
Senp7 T C 16: 56,165,952 S582P probably damaging Het
Slc16a14 A G 1: 84,922,884 S127P probably benign Het
Slc22a21 C T 11: 53,979,817 W14* probably null Het
Slc6a18 T A 13: 73,664,311 E553D probably benign Het
Speer4a T G 5: 26,038,238 N83T probably damaging Het
Svep1 T A 4: 58,070,119 S2556C possibly damaging Het
Tc2n T C 12: 101,694,592 N127S probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Thra T C 11: 98,763,650 V282A possibly damaging Het
Tmem161b A T 13: 84,272,169 probably null Het
Tmem218 C T 9: 37,222,519 A85V probably benign Het
Txnip T C 3: 96,558,936 Y100H probably damaging Het
Zfp462 T A 4: 55,051,313 I2262K probably damaging Het
Zfp804a A T 2: 82,257,762 D645V probably damaging Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141788940 missense probably damaging 0.99
IGL01089:Unc5c APN 3 141818202 splice site probably benign
IGL01478:Unc5c APN 3 141828451 missense probably damaging 1.00
IGL02083:Unc5c APN 3 141714647 missense probably damaging 0.99
IGL02269:Unc5c APN 3 141788982 missense probably damaging 1.00
IGL02565:Unc5c APN 3 141803919 missense probably damaging 1.00
IGL02973:Unc5c APN 3 141788890 missense probably benign 0.12
R0179:Unc5c UTSW 3 141818067 nonsense probably null
R0309:Unc5c UTSW 3 141733933 missense probably benign 0.01
R0371:Unc5c UTSW 3 141827522 missense probably benign 0.01
R0603:Unc5c UTSW 3 141771102 missense probably damaging 1.00
R0904:Unc5c UTSW 3 141803840 missense probably benign 0.08
R0907:Unc5c UTSW 3 141789033 missense probably damaging 0.99
R1300:Unc5c UTSW 3 141828543 missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141789822 missense probably damaging 1.00
R1494:Unc5c UTSW 3 141827549 missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141818103 missense probably damaging 1.00
R1750:Unc5c UTSW 3 141827517 missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141757757 missense probably damaging 1.00
R2381:Unc5c UTSW 3 141678155 missense probably damaging 1.00
R2394:Unc5c UTSW 3 141678131 missense probably damaging 1.00
R2945:Unc5c UTSW 3 141789974 missense probably damaging 0.97
R4284:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4285:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4287:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4681:Unc5c UTSW 3 141768613 critical splice donor site probably null
R4736:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4740:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4774:Unc5c UTSW 3 141828517 missense probably damaging 1.00
R4862:Unc5c UTSW 3 141789773 missense probably damaging 1.00
R4905:Unc5c UTSW 3 141801310 missense probably benign 0.19
R4921:Unc5c UTSW 3 141788966 missense probably damaging 1.00
R5150:Unc5c UTSW 3 141757793 missense probably damaging 1.00
R5559:Unc5c UTSW 3 141803787 missense probably damaging 1.00
R5562:Unc5c UTSW 3 141768530 missense probably damaging 1.00
R5643:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5644:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5775:Unc5c UTSW 3 141828520 missense probably damaging 1.00
R5912:Unc5c UTSW 3 141789006 missense probably damaging 1.00
R6154:Unc5c UTSW 3 141678153 missense probably damaging 0.97
R6547:Unc5c UTSW 3 141790019 missense probably benign 0.16
R6558:Unc5c UTSW 3 141789729 missense probably damaging 0.98
R7104:Unc5c UTSW 3 141733904 missense probably damaging 1.00
R7113:Unc5c UTSW 3 141801293 missense probably benign 0.00
R7282:Unc5c UTSW 3 141677990 missense probably damaging 0.98
R7317:Unc5c UTSW 3 141789942 missense probably benign 0.00
R7787:Unc5c UTSW 3 141768552 missense probably damaging 1.00
R7873:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7896:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R7936:Unc5c UTSW 3 141828477 missense possibly damaging 0.48
R8041:Unc5c UTSW 3 141465784 missense possibly damaging 0.92
R8277:Unc5c UTSW 3 141768612 critical splice donor site probably null
X0018:Unc5c UTSW 3 141714739 missense probably damaging 1.00
X0065:Unc5c UTSW 3 141827661 missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141733900 missense probably damaging 1.00
Z1176:Unc5c UTSW 3 141678010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTACATTCAGCTGGATGCAGAG -3'
(R):5'- GTAGCCCTTGGGAGGAATTAGC -3'

Sequencing Primer
(F):5'- ATGCAGAGGCTTGCCATATC -3'
(R):5'- ACAGCTTATTTATCAGCATGGCC -3'
Posted On2021-03-08