Incidental Mutation 'R8669:Unc5c'
ID 661034
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Name unc-5 netrin receptor C
Synonyms B130051O18Rik, Unc5h3
MMRRC Submission 068524-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8669 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 141171360-141540685 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141509704 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 728 (D728G)
Ref Sequence ENSEMBL: ENSMUSP00000074758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
AlphaFold O08747
Predicted Effect possibly damaging
Transcript: ENSMUST00000075282
AA Change: D728G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: D728G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106236
AA Change: D709G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: D709G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130636
AA Change: D654G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: D654G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142762
AA Change: D728G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: D728G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,949,234 (GRCm39) S305T probably benign Het
Ankrd42 A G 7: 92,268,881 (GRCm39) V154A possibly damaging Het
Apc2 C T 10: 80,149,491 (GRCm39) T1515I probably damaging Het
Blzf1 T A 1: 164,130,113 (GRCm39) N80Y possibly damaging Het
Cacna2d1 T C 5: 16,140,013 (GRCm39) M1T probably null Het
Ccdc125 T C 13: 100,832,683 (GRCm39) L420P probably damaging Het
Ccdc162 T C 10: 41,428,352 (GRCm39) T1976A probably benign Het
Cdc20b C T 13: 113,208,460 (GRCm39) P219S possibly damaging Het
Cep89 A G 7: 35,128,602 (GRCm39) D585G probably benign Het
Crnn A T 3: 93,056,296 (GRCm39) R361* probably null Het
Defb5 A G 8: 19,300,761 (GRCm39) I38V probably benign Het
Defb8 A G 8: 19,495,973 (GRCm39) V29A probably benign Het
Dgkh A G 14: 78,962,459 (GRCm39) V24A probably benign Het
Dhrs13 G C 11: 77,923,492 (GRCm39) R70P possibly damaging Het
Dnah12 A T 14: 26,552,582 (GRCm39) probably benign Het
Dsg2 A G 18: 20,723,132 (GRCm39) N386S probably damaging Het
Dyrk1a G T 16: 94,464,650 (GRCm39) R77L probably damaging Het
Fbxw19 G T 9: 109,313,482 (GRCm39) L239I probably benign Het
Gal3st2b A T 1: 93,868,764 (GRCm39) I332L possibly damaging Het
Gcnt1 T G 19: 17,307,143 (GRCm39) K194T probably benign Het
Gm7298 T C 6: 121,742,002 (GRCm39) W475R probably benign Het
Gpatch1 C A 7: 34,991,204 (GRCm39) W613C probably damaging Het
Gulp1 T A 1: 44,805,270 (GRCm39) S120T probably benign Het
Ift122 C A 6: 115,900,252 (GRCm39) Q946K probably damaging Het
Itpr1 T A 6: 108,370,928 (GRCm39) L1065H probably damaging Het
Kcnq5 T C 1: 21,476,050 (GRCm39) D579G probably damaging Het
Klhl40 T A 9: 121,607,088 (GRCm39) S83T probably benign Het
Krt19 T C 11: 100,031,993 (GRCm39) K320E probably damaging Het
Krt87 C A 15: 101,385,777 (GRCm39) V273L probably benign Het
Lgals4 C T 7: 28,540,921 (GRCm39) R282C probably damaging Het
Lrp1b A G 2: 41,172,047 (GRCm39) probably null Het
Lrrk1 G A 7: 65,912,344 (GRCm39) L1739F probably benign Het
Mthfr A G 4: 148,135,934 (GRCm39) N336D probably benign Het
Myo6 T G 9: 80,173,531 (GRCm39) L557R unknown Het
Naip2 T C 13: 100,325,477 (GRCm39) S144G probably benign Het
Nfatc1 T C 18: 80,725,406 (GRCm39) K453E probably damaging Het
Or52ab7 A T 7: 102,978,281 (GRCm39) D196V probably benign Het
Osm A T 11: 4,189,665 (GRCm39) I150L probably benign Het
Phtf1 T A 3: 103,910,792 (GRCm39) N639K probably benign Het
Prpf40b T A 15: 99,201,228 (GRCm39) M1K probably null Het
Rhbdl3 G A 11: 80,244,339 (GRCm39) V349M probably damaging Het
Senp7 T C 16: 55,986,315 (GRCm39) S582P probably damaging Het
Slc16a14 A G 1: 84,900,605 (GRCm39) S127P probably benign Het
Slc22a21 C T 11: 53,870,643 (GRCm39) W14* probably null Het
Slc6a18 T A 13: 73,812,430 (GRCm39) E553D probably benign Het
Speer4a1 T G 5: 26,243,236 (GRCm39) N83T probably damaging Het
Svep1 T A 4: 58,070,119 (GRCm39) S2556C possibly damaging Het
Tc2n T C 12: 101,660,851 (GRCm39) N127S probably damaging Het
Tcstv7b C A 13: 120,702,338 (GRCm39) P45T probably benign Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Thra T C 11: 98,654,476 (GRCm39) V282A possibly damaging Het
Tmem161b A T 13: 84,420,288 (GRCm39) probably null Het
Tmem218 C T 9: 37,133,815 (GRCm39) A85V probably benign Het
Txnip T C 3: 96,466,252 (GRCm39) Y100H probably damaging Het
Zfp462 T A 4: 55,051,313 (GRCm39) I2262K probably damaging Het
Zfp804a A T 2: 82,088,106 (GRCm39) D645V probably damaging Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141,494,701 (GRCm39) missense probably damaging 0.99
IGL01089:Unc5c APN 3 141,523,963 (GRCm39) splice site probably benign
IGL01478:Unc5c APN 3 141,534,212 (GRCm39) missense probably damaging 1.00
IGL02083:Unc5c APN 3 141,420,408 (GRCm39) missense probably damaging 0.99
IGL02269:Unc5c APN 3 141,494,743 (GRCm39) missense probably damaging 1.00
IGL02565:Unc5c APN 3 141,509,680 (GRCm39) missense probably damaging 1.00
IGL02973:Unc5c APN 3 141,494,651 (GRCm39) missense probably benign 0.12
R0179:Unc5c UTSW 3 141,523,828 (GRCm39) nonsense probably null
R0309:Unc5c UTSW 3 141,439,694 (GRCm39) missense probably benign 0.01
R0371:Unc5c UTSW 3 141,533,283 (GRCm39) missense probably benign 0.01
R0603:Unc5c UTSW 3 141,476,863 (GRCm39) missense probably damaging 1.00
R0904:Unc5c UTSW 3 141,509,601 (GRCm39) missense probably benign 0.08
R0907:Unc5c UTSW 3 141,494,794 (GRCm39) missense probably damaging 0.99
R1300:Unc5c UTSW 3 141,534,304 (GRCm39) missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141,495,583 (GRCm39) missense probably damaging 1.00
R1494:Unc5c UTSW 3 141,533,310 (GRCm39) missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141,463,598 (GRCm39) missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141,463,598 (GRCm39) missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141,523,864 (GRCm39) missense probably damaging 1.00
R1750:Unc5c UTSW 3 141,533,278 (GRCm39) missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141,463,518 (GRCm39) missense probably damaging 1.00
R2381:Unc5c UTSW 3 141,383,916 (GRCm39) missense probably damaging 1.00
R2394:Unc5c UTSW 3 141,383,892 (GRCm39) missense probably damaging 1.00
R2945:Unc5c UTSW 3 141,495,735 (GRCm39) missense probably damaging 0.97
R4284:Unc5c UTSW 3 141,420,435 (GRCm39) missense probably damaging 1.00
R4285:Unc5c UTSW 3 141,420,435 (GRCm39) missense probably damaging 1.00
R4287:Unc5c UTSW 3 141,420,435 (GRCm39) missense probably damaging 1.00
R4681:Unc5c UTSW 3 141,474,374 (GRCm39) critical splice donor site probably null
R4736:Unc5c UTSW 3 141,522,692 (GRCm39) missense probably benign 0.00
R4740:Unc5c UTSW 3 141,522,692 (GRCm39) missense probably benign 0.00
R4774:Unc5c UTSW 3 141,534,278 (GRCm39) missense probably damaging 1.00
R4862:Unc5c UTSW 3 141,495,534 (GRCm39) missense probably damaging 1.00
R4905:Unc5c UTSW 3 141,507,071 (GRCm39) missense probably benign 0.19
R4921:Unc5c UTSW 3 141,494,727 (GRCm39) missense probably damaging 1.00
R5150:Unc5c UTSW 3 141,463,554 (GRCm39) missense probably damaging 1.00
R5559:Unc5c UTSW 3 141,509,548 (GRCm39) missense probably damaging 1.00
R5562:Unc5c UTSW 3 141,474,291 (GRCm39) missense probably damaging 1.00
R5643:Unc5c UTSW 3 141,383,886 (GRCm39) missense probably damaging 1.00
R5644:Unc5c UTSW 3 141,383,886 (GRCm39) missense probably damaging 1.00
R5775:Unc5c UTSW 3 141,534,281 (GRCm39) missense probably damaging 1.00
R5912:Unc5c UTSW 3 141,494,767 (GRCm39) missense probably damaging 1.00
R6154:Unc5c UTSW 3 141,383,914 (GRCm39) missense probably damaging 0.97
R6547:Unc5c UTSW 3 141,495,780 (GRCm39) missense probably benign 0.16
R6558:Unc5c UTSW 3 141,495,490 (GRCm39) missense probably damaging 0.98
R7104:Unc5c UTSW 3 141,439,665 (GRCm39) missense probably damaging 1.00
R7113:Unc5c UTSW 3 141,507,054 (GRCm39) missense probably benign 0.00
R7282:Unc5c UTSW 3 141,383,751 (GRCm39) missense probably damaging 0.98
R7317:Unc5c UTSW 3 141,495,703 (GRCm39) missense probably benign 0.00
R7787:Unc5c UTSW 3 141,474,313 (GRCm39) missense probably damaging 1.00
R7873:Unc5c UTSW 3 141,533,310 (GRCm39) missense probably benign 0.04
R7896:Unc5c UTSW 3 141,476,922 (GRCm39) missense possibly damaging 0.73
R7936:Unc5c UTSW 3 141,534,238 (GRCm39) missense possibly damaging 0.48
R8041:Unc5c UTSW 3 141,171,545 (GRCm39) missense possibly damaging 0.92
R8277:Unc5c UTSW 3 141,474,373 (GRCm39) critical splice donor site probably null
R8886:Unc5c UTSW 3 141,509,581 (GRCm39) missense probably benign 0.02
R8989:Unc5c UTSW 3 141,509,467 (GRCm39) splice site probably benign
R9244:Unc5c UTSW 3 141,533,370 (GRCm39) missense probably benign 0.00
R9444:Unc5c UTSW 3 141,507,209 (GRCm39) critical splice donor site probably null
R9508:Unc5c UTSW 3 141,494,736 (GRCm39) missense possibly damaging 0.75
R9524:Unc5c UTSW 3 141,494,683 (GRCm39) missense possibly damaging 0.56
R9633:Unc5c UTSW 3 141,495,654 (GRCm39) missense probably damaging 0.99
X0018:Unc5c UTSW 3 141,420,500 (GRCm39) missense probably damaging 1.00
X0065:Unc5c UTSW 3 141,533,422 (GRCm39) missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141,439,661 (GRCm39) missense probably damaging 1.00
Z1176:Unc5c UTSW 3 141,383,771 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTACATTCAGCTGGATGCAGAG -3'
(R):5'- GTAGCCCTTGGGAGGAATTAGC -3'

Sequencing Primer
(F):5'- ATGCAGAGGCTTGCCATATC -3'
(R):5'- ACAGCTTATTTATCAGCATGGCC -3'
Posted On 2021-03-08