Incidental Mutation 'R8669:Olfr598'
ID 661049
Institutional Source Beutler Lab
Gene Symbol Olfr598
Ensembl Gene ENSMUSG00000073951
Gene Name olfactory receptor 598
Synonyms GA_x6K02T2PBJ9-6037823-6038782, MOR23-4P, MOR23-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock # R8669 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 103323568-103329888 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103329074 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 196 (D196V)
Ref Sequence ENSEMBL: ENSMUSP00000149199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098202] [ENSMUST00000214765]
AlphaFold Q7TRR2
Predicted Effect probably benign
Transcript: ENSMUST00000098202
AA Change: D196V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000100474
Gene: ENSMUSG00000073951
AA Change: D196V

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 2.3e-89 PFAM
Pfam:7TM_GPCR_Srsx 41 312 9e-7 PFAM
Pfam:7tm_1 47 297 2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214765
AA Change: D196V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,902,460 S305T probably benign Het
Ankrd42 A G 7: 92,619,673 V154A possibly damaging Het
Apc2 C T 10: 80,313,657 T1515I probably damaging Het
Blzf1 T A 1: 164,302,544 N80Y possibly damaging Het
Cacna2d1 T C 5: 15,935,015 M1T probably null Het
Ccdc125 T C 13: 100,696,175 L420P probably damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cdc20b C T 13: 113,071,926 P219S possibly damaging Het
Cep89 A G 7: 35,429,177 D585G probably benign Het
Crnn A T 3: 93,148,989 R361* probably null Het
Defb5 A G 8: 19,250,745 I38V probably benign Het
Defb8 A G 8: 19,445,957 V29A probably benign Het
Dgkh A G 14: 78,725,019 V24A probably benign Het
Dhrs13 G C 11: 78,032,666 R70P possibly damaging Het
Dnah12 A T 14: 26,830,625 probably benign Het
Dsg2 A G 18: 20,590,075 N386S probably damaging Het
Dyrk1a G T 16: 94,663,791 R77L probably damaging Het
Fbxw19 G T 9: 109,484,414 L239I probably benign Het
Gal3st2b A T 1: 93,941,042 I332L possibly damaging Het
Gcnt1 T G 19: 17,329,779 K194T probably benign Het
Gm21731 C A 13: 120,240,802 P45T probably benign Het
Gm7298 T C 6: 121,765,043 W475R probably benign Het
Gpatch1 C A 7: 35,291,779 W613C probably damaging Het
Gulp1 T A 1: 44,766,110 S120T probably benign Het
Ift122 C A 6: 115,923,291 Q946K probably damaging Het
Itpr1 T A 6: 108,393,967 L1065H probably damaging Het
Kcnq5 T C 1: 21,405,826 D579G probably damaging Het
Klhl40 T A 9: 121,778,022 S83T probably benign Het
Krt19 T C 11: 100,141,167 K320E probably damaging Het
Krt83 C A 15: 101,487,896 V273L probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrp1b A G 2: 41,282,035 probably null Het
Lrrk1 G A 7: 66,262,596 L1739F probably benign Het
Mthfr A G 4: 148,051,477 N336D probably benign Het
Myo6 T G 9: 80,266,249 L557R unknown Het
Naip2 T C 13: 100,188,969 S144G probably benign Het
Nfatc1 T C 18: 80,682,191 K453E probably damaging Het
Osm A T 11: 4,239,665 I150L probably benign Het
Phtf1 T A 3: 104,003,476 N639K probably benign Het
Prpf40b T A 15: 99,303,347 M1K probably null Het
Rhbdl3 G A 11: 80,353,513 V349M probably damaging Het
Senp7 T C 16: 56,165,952 S582P probably damaging Het
Slc16a14 A G 1: 84,922,884 S127P probably benign Het
Slc22a21 C T 11: 53,979,817 W14* probably null Het
Slc6a18 T A 13: 73,664,311 E553D probably benign Het
Speer4a T G 5: 26,038,238 N83T probably damaging Het
Svep1 T A 4: 58,070,119 S2556C possibly damaging Het
Tc2n T C 12: 101,694,592 N127S probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Thra T C 11: 98,763,650 V282A possibly damaging Het
Tmem161b A T 13: 84,272,169 probably null Het
Tmem218 C T 9: 37,222,519 A85V probably benign Het
Txnip T C 3: 96,558,936 Y100H probably damaging Het
Unc5c A G 3: 141,803,943 D728G possibly damaging Het
Zfp462 T A 4: 55,051,313 I2262K probably damaging Het
Zfp804a A T 2: 82,257,762 D645V probably damaging Het
Other mutations in Olfr598
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Olfr598 APN 7 103329321 missense probably damaging 1.00
IGL01911:Olfr598 APN 7 103329273 missense probably benign 0.30
IGL02225:Olfr598 APN 7 103329166 missense probably damaging 1.00
IGL02687:Olfr598 APN 7 103329400 nonsense probably null
IGL03214:Olfr598 APN 7 103328666 missense possibly damaging 0.95
R0544:Olfr598 UTSW 7 103328651 missense probably damaging 1.00
R0555:Olfr598 UTSW 7 103328963 missense probably benign
R1081:Olfr598 UTSW 7 103329038 missense probably damaging 1.00
R1802:Olfr598 UTSW 7 103328647 missense probably benign 0.09
R2092:Olfr598 UTSW 7 103329109 missense probably damaging 1.00
R2197:Olfr598 UTSW 7 103328624 nonsense probably null
R3974:Olfr598 UTSW 7 103329078 missense probably damaging 0.98
R4227:Olfr598 UTSW 7 103328819 missense probably damaging 0.97
R4809:Olfr598 UTSW 7 103328523 nonsense probably null
R4977:Olfr598 UTSW 7 103328833 missense probably benign 0.00
R5324:Olfr598 UTSW 7 103329050 missense probably damaging 1.00
R5478:Olfr598 UTSW 7 103328825 missense probably damaging 1.00
R6238:Olfr598 UTSW 7 103328908 missense possibly damaging 0.95
R6797:Olfr598 UTSW 7 103329121 missense probably benign
R7062:Olfr598 UTSW 7 103329086 missense probably benign 0.10
R7079:Olfr598 UTSW 7 103329184 missense probably benign 0.00
R7539:Olfr598 UTSW 7 103328494 missense probably benign 0.01
R8854:Olfr598 UTSW 7 103328816 missense probably damaging 0.98
R8878:Olfr598 UTSW 7 103329005 missense possibly damaging 0.67
R9297:Olfr598 UTSW 7 103329376 missense probably damaging 1.00
R9318:Olfr598 UTSW 7 103329376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTGAGGCACACATCTATTC -3'
(R):5'- ACAACATGGCCAAGACGGTG -3'

Sequencing Primer
(F):5'- TGAGGCACACATCTATTCTTACAC -3'
(R):5'- AGGAGAAAAAGGCAAGAATATAGAAC -3'
Posted On 2021-03-08