Incidental Mutation 'R8669:Rhbdl3'
ID661061
Institutional Source Beutler Lab
Gene Symbol Rhbdl3
Ensembl Gene ENSMUSG00000017692
Gene Namerhomboid like 3
SynonymsVrho, Ventrhoid, Rhbdl4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R8669 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location80300912-80355955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80353513 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 349 (V349M)
Ref Sequence ENSEMBL: ENSMUSP00000017836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017836]
Predicted Effect probably damaging
Transcript: ENSMUST00000017836
AA Change: V349M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017836
Gene: ENSMUSG00000017692
AA Change: V349M

DomainStartEndE-ValueType
SCOP:d1c7va_ 36 104 2e-12 SMART
Blast:EFh 38 66 6e-11 BLAST
PDB:2RRT|A 43 102 6e-6 PDB
Blast:EFh 74 102 9e-10 BLAST
transmembrane domain 162 184 N/A INTRINSIC
Pfam:Rhomboid 205 362 1.6e-34 PFAM
transmembrane domain 370 392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,902,460 S305T probably benign Het
Ankrd42 A G 7: 92,619,673 V154A possibly damaging Het
Apc2 C T 10: 80,313,657 T1515I probably damaging Het
Blzf1 T A 1: 164,302,544 N80Y possibly damaging Het
Cacna2d1 T C 5: 15,935,015 M1T probably null Het
Ccdc125 T C 13: 100,696,175 L420P probably damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cdc20b C T 13: 113,071,926 P219S possibly damaging Het
Cep89 A G 7: 35,429,177 D585G probably benign Het
Crnn A T 3: 93,148,989 R361* probably null Het
Defb5 A G 8: 19,250,745 I38V probably benign Het
Defb8 A G 8: 19,445,957 V29A probably benign Het
Dgkh A G 14: 78,725,019 V24A probably benign Het
Dhrs13 G C 11: 78,032,666 R70P possibly damaging Het
Dsg2 A G 18: 20,590,075 N386S probably damaging Het
Dyrk1a G T 16: 94,663,791 R77L probably damaging Het
Fbxw19 G T 9: 109,484,414 L239I probably benign Het
Gal3st2b A T 1: 93,941,042 I332L possibly damaging Het
Gcnt1 T G 19: 17,329,779 K194T probably benign Het
Gm21731 C A 13: 120,240,802 P45T probably benign Het
Gm7298 T C 6: 121,765,043 W475R probably benign Het
Gpatch1 C A 7: 35,291,779 W613C probably damaging Het
Gulp1 T A 1: 44,766,110 S120T probably benign Het
Ift122 C A 6: 115,923,291 Q946K probably damaging Het
Itpr1 T A 6: 108,393,967 L1065H probably damaging Het
Kcnq5 T C 1: 21,405,826 D579G probably damaging Het
Klhl40 T A 9: 121,778,022 S83T probably benign Het
Krt19 T C 11: 100,141,167 K320E probably damaging Het
Krt83 C A 15: 101,487,896 V273L probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrp1b A G 2: 41,282,035 probably null Het
Lrrk1 G A 7: 66,262,596 L1739F probably benign Het
Mthfr A G 4: 148,051,477 N336D probably benign Het
Myo6 T G 9: 80,266,249 L557R unknown Het
Naip2 T C 13: 100,188,969 S144G probably benign Het
Nfatc1 T C 18: 80,682,191 K453E probably damaging Het
Olfr598 A T 7: 103,329,074 D196V probably benign Het
Osm A T 11: 4,239,665 I150L probably benign Het
Phtf1 T A 3: 104,003,476 N639K probably benign Het
Prpf40b T A 15: 99,303,347 M1K probably null Het
Senp7 T C 16: 56,165,952 S582P probably damaging Het
Slc16a14 A G 1: 84,922,884 S127P probably benign Het
Slc22a21 C T 11: 53,979,817 W14* probably null Het
Slc6a18 T A 13: 73,664,311 E553D probably benign Het
Speer4a T G 5: 26,038,238 N83T probably damaging Het
Svep1 T A 4: 58,070,119 S2556C possibly damaging Het
Tc2n T C 12: 101,694,592 N127S probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Thra T C 11: 98,763,650 V282A possibly damaging Het
Tmem161b A T 13: 84,272,169 probably null Het
Tmem218 C T 9: 37,222,519 A85V probably benign Het
Txnip T C 3: 96,558,936 Y100H probably damaging Het
Unc5c A G 3: 141,803,943 D728G possibly damaging Het
Zfp462 T A 4: 55,051,313 I2262K probably damaging Het
Zfp804a A T 2: 82,257,762 D645V probably damaging Het
Other mutations in Rhbdl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Rhbdl3 APN 11 80353442 missense probably damaging 1.00
IGL02003:Rhbdl3 APN 11 80337516 missense possibly damaging 0.82
IGL02302:Rhbdl3 APN 11 80353681 makesense probably null
IGL02972:Rhbdl3 APN 11 80331916 splice site probably benign
IGL03028:Rhbdl3 APN 11 80323461 nonsense probably null
IGL03033:Rhbdl3 APN 11 80346827 missense probably damaging 0.99
IGL03113:Rhbdl3 APN 11 80353613 missense possibly damaging 0.69
R0193:Rhbdl3 UTSW 11 80353574 missense possibly damaging 0.55
R0358:Rhbdl3 UTSW 11 80353631 missense probably damaging 0.99
R0481:Rhbdl3 UTSW 11 80323349 splice site probably benign
R0616:Rhbdl3 UTSW 11 80331861 missense probably damaging 0.99
R1171:Rhbdl3 UTSW 11 80353592 missense possibly damaging 0.52
R2166:Rhbdl3 UTSW 11 80319697 missense probably damaging 1.00
R3500:Rhbdl3 UTSW 11 80319705 missense probably damaging 0.98
R4580:Rhbdl3 UTSW 11 80353645 missense probably damaging 1.00
R4900:Rhbdl3 UTSW 11 80319613 missense probably benign 0.13
R5276:Rhbdl3 UTSW 11 80319666 missense probably benign 0.07
R5513:Rhbdl3 UTSW 11 80331842 missense probably damaging 0.99
R5595:Rhbdl3 UTSW 11 80337583 missense probably damaging 0.99
R5941:Rhbdl3 UTSW 11 80331889 missense probably benign 0.18
R6372:Rhbdl3 UTSW 11 80330656 missense probably damaging 1.00
R6935:Rhbdl3 UTSW 11 80337496 missense probably damaging 1.00
R7252:Rhbdl3 UTSW 11 80337585 missense possibly damaging 0.60
R7389:Rhbdl3 UTSW 11 80346839 missense possibly damaging 0.95
R7404:Rhbdl3 UTSW 11 80346833 missense probably damaging 1.00
R7745:Rhbdl3 UTSW 11 80323579 missense possibly damaging 0.74
R7768:Rhbdl3 UTSW 11 80330621 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAGTTAATGGACGCTGGG -3'
(R):5'- ACTTTCTCGGGATGCTTCTG -3'

Sequencing Primer
(F):5'- TAATGGACGCTGGGTGGCC -3'
(R):5'- GACCTCTGGTCCCTTAGGG -3'
Posted On2021-03-08