Incidental Mutation 'R0238:Mcam'
Institutional Source Beutler Lab
Gene Symbol Mcam
Ensembl Gene ENSMUSG00000032135
Gene Namemelanoma cell adhesion molecule
SynonymsMuc18, CD146, s-gicerin, 1-gicerin, s-endo
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R0238 (G1)
Quality Score225
Status Not validated
Chromosomal Location44134469-44142727 bp(+) (GRCm38)
Type of Mutationunclassified (3136 bp from exon)
DNA Base Change (assembly) T to G at 44140205 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034650] [ENSMUST00000098852] [ENSMUST00000147836] [ENSMUST00000149241] [ENSMUST00000206147] [ENSMUST00000206720] [ENSMUST00000216002]
Predicted Effect probably damaging
Transcript: ENSMUST00000034650
AA Change: C454G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034650
Gene: ENSMUSG00000032135
AA Change: C454G

signal peptide 1 23 N/A INTRINSIC
IG 35 135 6.61e-4 SMART
IG_like 155 213 4.22e-1 SMART
IG 259 343 8.13e-4 SMART
IGc2 358 416 3.4e-6 SMART
IG_like 445 508 1.92e0 SMART
low complexity region 511 525 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098852
AA Change: C454G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096451
Gene: ENSMUSG00000032135
AA Change: C454G

signal peptide 1 23 N/A INTRINSIC
IG 35 135 6.61e-4 SMART
IG_like 155 213 4.22e-1 SMART
IG 259 343 8.13e-4 SMART
IGc2 358 416 3.4e-6 SMART
IG_like 445 508 1.92e0 SMART
low complexity region 511 525 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132490
Predicted Effect probably null
Transcript: ENSMUST00000147836
SMART Domains Protein: ENSMUSP00000117924
Gene: ENSMUSG00000032135

Pfam:V-set 2 97 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149241
SMART Domains Protein: ENSMUSP00000121090
Gene: ENSMUSG00000032135

signal peptide 1 23 N/A INTRINSIC
low complexity region 64 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206163
Predicted Effect probably benign
Transcript: ENSMUST00000206720
Predicted Effect probably null
Transcript: ENSMUST00000216002
Meta Mutation Damage Score 0.9675 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 92.6%
  • 20x: 76.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in endothelial cells exhibit impaired VEGF-induced angiogenesis in Matrigel. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gm20422 T C 8: 69,766,715 Y53C probably damaging Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Other mutations in Mcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02408:Mcam APN 9 44140250 missense probably benign 0.01
IGL02671:Mcam APN 9 44137034 splice site probably benign
IGL02682:Mcam APN 9 44140417 missense possibly damaging 0.80
IGL03384:Mcam APN 9 44140512 unclassified probably benign
R0238:Mcam UTSW 9 44140205 unclassified probably null
R0320:Mcam UTSW 9 44140186 missense possibly damaging 0.89
R1432:Mcam UTSW 9 44141291 missense probably damaging 0.98
R1485:Mcam UTSW 9 44136763 missense probably damaging 1.00
R1503:Mcam UTSW 9 44141291 missense probably damaging 0.98
R1730:Mcam UTSW 9 44134706 missense probably damaging 1.00
R1783:Mcam UTSW 9 44134706 missense probably damaging 1.00
R2146:Mcam UTSW 9 44136635 missense probably damaging 0.99
R2150:Mcam UTSW 9 44136635 missense probably damaging 0.99
R2215:Mcam UTSW 9 44139953 nonsense probably null
R4366:Mcam UTSW 9 44134697 missense probably damaging 1.00
R4519:Mcam UTSW 9 44141343 missense possibly damaging 0.95
R4948:Mcam UTSW 9 44136566 missense probably damaging 1.00
R5965:Mcam UTSW 9 44136628 missense probably damaging 1.00
R6704:Mcam UTSW 9 44136920 missense probably benign 0.06
R6955:Mcam UTSW 9 44139269 missense probably damaging 1.00
R7273:Mcam UTSW 9 44140944 missense possibly damaging 0.78
R7529:Mcam UTSW 9 44138895 missense probably benign 0.08
R7623:Mcam UTSW 9 44139658 missense probably benign 0.28
R7659:Mcam UTSW 9 44136770 missense unknown
R8066:Mcam UTSW 9 44140960 missense probably damaging 1.00
Z1177:Mcam UTSW 9 44134590 unclassified probably benign
Predicted Primers
Posted On2013-08-19