Incidental Mutation 'R8670:Klhl22'
ID661123
Institutional Source Beutler Lab
Gene Symbol Klhl22
Ensembl Gene ENSMUSG00000022750
Gene Namekelch-like 22
SynonymsKelchl, 2610318I18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R8670 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location17759618-17793382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17776463 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 152 (I152N)
Ref Sequence ENSEMBL: ENSMUSP00000112412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120488] [ENSMUST00000126600] [ENSMUST00000129199] [ENSMUST00000140306] [ENSMUST00000165790]
Predicted Effect probably damaging
Transcript: ENSMUST00000120488
AA Change: I152N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112412
Gene: ENSMUSG00000022750
AA Change: I152N

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126600
SMART Domains Protein: ENSMUSP00000118696
Gene: ENSMUSG00000022750

DomainStartEndE-ValueType
Pfam:BTB 40 115 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129199
SMART Domains Protein: ENSMUSP00000119191
Gene: ENSMUSG00000022750

DomainStartEndE-ValueType
BTB 50 117 3.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140306
SMART Domains Protein: ENSMUSP00000122145
Gene: ENSMUSG00000022750

DomainStartEndE-ValueType
BTB 50 130 5.11e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165790
AA Change: I152N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127227
Gene: ENSMUSG00000022750
AA Change: I152N

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik A G 13: 24,746,257 E162G probably benign Het
Abca8a A T 11: 110,075,598 L403Q probably damaging Het
Actl11 T C 9: 107,928,760 F94S possibly damaging Het
Adam34 C T 8: 43,652,089 C173Y possibly damaging Het
Ankrd24 C T 10: 81,629,692 probably benign Het
Atp12a A T 14: 56,380,089 D612V probably damaging Het
Cacna2d1 T C 5: 15,935,015 M1T probably null Het
Ccdc178 T C 18: 22,097,662 E384G possibly damaging Het
Cd82 T A 2: 93,420,560 T212S probably benign Het
Cdk17 T A 10: 93,226,096 L263* probably null Het
Cfap57 T G 4: 118,614,925 I86L possibly damaging Het
Chd5 T C 4: 152,385,496 M1842T possibly damaging Het
Clcn7 T C 17: 25,159,614 F691S probably damaging Het
Cpvl A T 6: 53,974,795 M1K probably null Het
Cym T C 3: 107,211,496 probably null Het
Diaph3 T C 14: 86,656,399 E1147G probably benign Het
Dirc2 G T 16: 35,735,635 Q152K possibly damaging Het
Eif4g3 T G 4: 138,158,512 probably null Het
Esp3 A G 17: 40,632,149 D11G probably benign Het
Exoc1 A G 5: 76,569,658 Y865C probably damaging Het
Flg2 A T 3: 93,201,484 Q273L probably damaging Het
Fuca1 G A 4: 135,922,971 V118I possibly damaging Het
Gga3 T C 11: 115,587,716 N417D probably benign Het
Gm5724 G A 6: 141,765,742 T81I possibly damaging Het
Gm9573 T A 17: 35,621,648 T549S unknown Het
Il1rl1 A T 1: 40,441,399 I63F probably damaging Het
Kif26b A G 1: 178,913,784 Y785C probably damaging Het
Kif5b A C 18: 6,214,631 S599A probably benign Het
Mex3c GC G 18: 73,589,705 probably null Het
Olfr229 A G 9: 39,910,423 I207V probably benign Het
Olfr668 A T 7: 104,925,212 M184K probably damaging Het
Orc3 A T 4: 34,572,529 I633N probably damaging Het
Pclo G A 5: 14,682,047 R3521H unknown Het
Plec A G 15: 76,177,526 L2737P probably damaging Het
Prom1 T A 5: 44,001,844 I813F probably benign Het
Prpf40b T A 15: 99,309,740 M517K probably damaging Het
Rab8a TA TAA 8: 72,171,286 probably null Het
Rnf213 T C 11: 119,458,737 L3808P Het
Scnn1b A G 7: 121,899,249 K4R probably benign Het
Siglec1 A G 2: 131,081,467 S453P probably damaging Het
Sim1 A G 10: 50,908,753 K165E probably damaging Het
Smarce1 T C 11: 99,210,272 T345A possibly damaging Het
Spty2d1 T C 7: 46,997,771 N470S probably benign Het
Stab2 T A 10: 86,940,723 D763V probably damaging Het
Tbl1xr1 A T 3: 22,191,000 E171D probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tex15 T A 8: 33,574,718 I1392K probably benign Het
Thada T C 17: 84,432,346 E827G probably benign Het
Ttc3 A G 16: 94,390,208 Y185C probably damaging Het
Vmn2r18 C A 5: 151,562,389 D547Y probably damaging Het
Wdpcp T C 11: 21,695,196 V208A probably benign Het
Zfp322a T A 13: 23,357,104 Q156L possibly damaging Het
Zfp947 T C 17: 22,145,706 D329G probably benign Het
Other mutations in Klhl22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Klhl22 APN 16 17776462 missense probably benign 0.03
IGL01973:Klhl22 APN 16 17792711 missense probably benign 0.00
IGL02115:Klhl22 APN 16 17776595 missense probably damaging 0.99
IGL02383:Klhl22 APN 16 17776898 missense possibly damaging 0.60
IGL03381:Klhl22 APN 16 17792727 missense possibly damaging 0.71
R0562:Klhl22 UTSW 16 17792624 missense probably benign
R0811:Klhl22 UTSW 16 17792589 missense probably benign 0.01
R0812:Klhl22 UTSW 16 17792589 missense probably benign 0.01
R1661:Klhl22 UTSW 16 17776488 missense probably benign 0.01
R1665:Klhl22 UTSW 16 17776488 missense probably benign 0.01
R1732:Klhl22 UTSW 16 17777024 missense probably damaging 1.00
R1902:Klhl22 UTSW 16 17771787 missense probably damaging 1.00
R2042:Klhl22 UTSW 16 17792420 unclassified probably benign
R2083:Klhl22 UTSW 16 17776525 missense probably benign
R4368:Klhl22 UTSW 16 17789273 missense possibly damaging 0.94
R4860:Klhl22 UTSW 16 17777016 synonymous silent
R6413:Klhl22 UTSW 16 17789317 missense probably benign 0.01
R7031:Klhl22 UTSW 16 17777026 missense probably damaging 1.00
R7095:Klhl22 UTSW 16 17792750 missense probably damaging 0.98
R7378:Klhl22 UTSW 16 17776805 missense probably damaging 1.00
R7565:Klhl22 UTSW 16 17789284 missense probably damaging 1.00
R8051:Klhl22 UTSW 16 17792579 missense probably damaging 0.99
R8153:Klhl22 UTSW 16 17792550 missense probably damaging 0.99
R8732:Klhl22 UTSW 16 17771826 missense probably damaging 0.98
Z1088:Klhl22 UTSW 16 17776543 missense possibly damaging 0.86
Z1176:Klhl22 UTSW 16 17776696 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AACATGCCCTGTGTTACCAC -3'
(R):5'- AAACCTCCAGGCGATTGCTG -3'

Sequencing Primer
(F):5'- CAGCAGGTTTTAAACTAAGCCTACAG -3'
(R):5'- TGCTGAGGAGAGAGTAGACCTTCTC -3'
Posted On2021-03-08