Incidental Mutation 'R8670:Clcn7'
ID 661127
Institutional Source Beutler Lab
Gene Symbol Clcn7
Ensembl Gene ENSMUSG00000036636
Gene Name chloride channel, voltage-sensitive 7
Synonyms ClC-7
MMRRC Submission 068525-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8670 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 25352365-25381078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25378588 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 691 (F691S)
Ref Sequence ENSEMBL: ENSMUSP00000035964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000073277] [ENSMUST00000160961] [ENSMUST00000182292] [ENSMUST00000182621] [ENSMUST00000183178]
AlphaFold O70496
Predicted Effect probably damaging
Transcript: ENSMUST00000040729
AA Change: F691S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: F691S

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073277
SMART Domains Protein: ENSMUSP00000073002
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 48 578 1.4e-263 PFAM
low complexity region 631 642 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160961
AA Change: F671S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: F671S

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162862
SMART Domains Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
Pfam:Voltage_CLC 5 307 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182292
SMART Domains Protein: ENSMUSP00000138191
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 571 1.3e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182621
SMART Domains Protein: ENSMUSP00000138090
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 573 2.9e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183178
SMART Domains Protein: ENSMUSP00000138659
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 109,966,424 (GRCm39) L403Q probably damaging Het
Actl11 T C 9: 107,805,959 (GRCm39) F94S possibly damaging Het
Adam34 C T 8: 44,105,126 (GRCm39) C173Y possibly damaging Het
Ankrd24 C T 10: 81,465,526 (GRCm39) probably benign Het
Armh2 A G 13: 24,930,240 (GRCm39) E162G probably benign Het
Atp12a A T 14: 56,617,546 (GRCm39) D612V probably damaging Het
Cacna2d1 T C 5: 16,140,013 (GRCm39) M1T probably null Het
Ccdc178 T C 18: 22,230,719 (GRCm39) E384G possibly damaging Het
Cd82 T A 2: 93,250,905 (GRCm39) T212S probably benign Het
Cdk17 T A 10: 93,061,958 (GRCm39) L263* probably null Het
Cfap57 T G 4: 118,472,122 (GRCm39) I86L possibly damaging Het
Chd5 T C 4: 152,469,953 (GRCm39) M1842T possibly damaging Het
Cpvl A T 6: 53,951,780 (GRCm39) M1K probably null Het
Cym T C 3: 107,118,812 (GRCm39) probably null Het
Diaph3 T C 14: 86,893,835 (GRCm39) E1147G probably benign Het
Eif4g3 T G 4: 137,885,823 (GRCm39) probably null Het
Esp3 A G 17: 40,943,040 (GRCm39) D11G probably benign Het
Exoc1 A G 5: 76,717,505 (GRCm39) Y865C probably damaging Het
Flg2 A T 3: 93,108,791 (GRCm39) Q273L probably damaging Het
Fuca1 G A 4: 135,650,282 (GRCm39) V118I possibly damaging Het
Gga3 T C 11: 115,478,542 (GRCm39) N417D probably benign Het
Il1rl1 A T 1: 40,480,559 (GRCm39) I63F probably damaging Het
Kif26b A G 1: 178,741,349 (GRCm39) Y785C probably damaging Het
Kif5b A C 18: 6,214,631 (GRCm39) S599A probably benign Het
Klhl22 T A 16: 17,594,327 (GRCm39) I152N probably damaging Het
Mex3c GC G 18: 73,722,776 (GRCm39) probably null Het
Muc21 T A 17: 35,932,540 (GRCm39) T549S unknown Het
Or52n2c A T 7: 104,574,419 (GRCm39) M184K probably damaging Het
Or8g2 A G 9: 39,821,719 (GRCm39) I207V probably benign Het
Orc3 A T 4: 34,572,529 (GRCm39) I633N probably damaging Het
Pclo G A 5: 14,732,061 (GRCm39) R3521H unknown Het
Plec A G 15: 76,061,726 (GRCm39) L2737P probably damaging Het
Prom1 T A 5: 44,159,186 (GRCm39) I813F probably benign Het
Prpf40b T A 15: 99,207,621 (GRCm39) M517K probably damaging Het
Rab8a TA TAA 8: 72,925,130 (GRCm39) probably null Het
Rnf213 T C 11: 119,349,563 (GRCm39) L3808P Het
Scnn1b A G 7: 121,498,472 (GRCm39) K4R probably benign Het
Siglec1 A G 2: 130,923,387 (GRCm39) S453P probably damaging Het
Sim1 A G 10: 50,784,849 (GRCm39) K165E probably damaging Het
Slc49a4 G T 16: 35,556,005 (GRCm39) Q152K possibly damaging Het
Slco1a7 G A 6: 141,711,468 (GRCm39) T81I possibly damaging Het
Smarce1 T C 11: 99,101,098 (GRCm39) T345A possibly damaging Het
Spty2d1 T C 7: 46,647,519 (GRCm39) N470S probably benign Het
Stab2 T A 10: 86,776,587 (GRCm39) D763V probably damaging Het
Tbl1xr1 A T 3: 22,245,164 (GRCm39) E171D probably damaging Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tex15 T A 8: 34,064,746 (GRCm39) I1392K probably benign Het
Thada T C 17: 84,739,774 (GRCm39) E827G probably benign Het
Ttc3 A G 16: 94,191,067 (GRCm39) Y185C probably damaging Het
Vmn2r18 C A 5: 151,485,854 (GRCm39) D547Y probably damaging Het
Wdpcp T C 11: 21,645,196 (GRCm39) V208A probably benign Het
Zfp322a T A 13: 23,541,274 (GRCm39) Q156L possibly damaging Het
Zfp947 T C 17: 22,364,687 (GRCm39) D329G probably benign Het
Other mutations in Clcn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clcn7 APN 17 25,370,097 (GRCm39) missense probably damaging 1.00
IGL01735:Clcn7 APN 17 25,370,090 (GRCm39) missense probably benign 0.13
IGL01912:Clcn7 APN 17 25,371,983 (GRCm39) splice site probably benign
IGL01936:Clcn7 APN 17 25,374,350 (GRCm39) missense probably benign 0.44
IGL02084:Clcn7 APN 17 25,376,899 (GRCm39) missense probably benign
IGL02121:Clcn7 APN 17 25,372,058 (GRCm39) missense possibly damaging 0.95
IGL02160:Clcn7 APN 17 25,368,004 (GRCm39) unclassified probably benign
IGL02335:Clcn7 APN 17 25,365,821 (GRCm39) missense probably benign 0.00
IGL02507:Clcn7 APN 17 25,363,443 (GRCm39) missense probably damaging 1.00
IGL02605:Clcn7 APN 17 25,365,792 (GRCm39) missense possibly damaging 0.60
IGL03160:Clcn7 APN 17 25,365,427 (GRCm39) unclassified probably benign
IGL03192:Clcn7 APN 17 25,352,575 (GRCm39) missense probably benign 0.00
IGL03194:Clcn7 APN 17 25,369,522 (GRCm39) missense probably damaging 0.98
IGL03409:Clcn7 APN 17 25,374,359 (GRCm39) missense probably damaging 1.00
R0140:Clcn7 UTSW 17 25,372,728 (GRCm39) missense probably damaging 1.00
R0153:Clcn7 UTSW 17 25,368,176 (GRCm39) unclassified probably benign
R0970:Clcn7 UTSW 17 25,370,208 (GRCm39) critical splice donor site probably null
R1644:Clcn7 UTSW 17 25,378,672 (GRCm39) missense probably damaging 1.00
R1856:Clcn7 UTSW 17 25,379,445 (GRCm39) missense probably damaging 1.00
R2145:Clcn7 UTSW 17 25,363,425 (GRCm39) missense probably benign
R2173:Clcn7 UTSW 17 25,364,583 (GRCm39) missense probably benign
R2401:Clcn7 UTSW 17 25,372,114 (GRCm39) missense probably benign 0.02
R2511:Clcn7 UTSW 17 25,374,420 (GRCm39) missense probably damaging 1.00
R3683:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3684:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3694:Clcn7 UTSW 17 25,378,681 (GRCm39) missense probably damaging 0.99
R4424:Clcn7 UTSW 17 25,379,150 (GRCm39) missense probably damaging 1.00
R4681:Clcn7 UTSW 17 25,376,935 (GRCm39) missense probably damaging 1.00
R4870:Clcn7 UTSW 17 25,372,539 (GRCm39) intron probably benign
R5372:Clcn7 UTSW 17 25,376,153 (GRCm39) missense possibly damaging 0.82
R5820:Clcn7 UTSW 17 25,368,026 (GRCm39) missense probably damaging 1.00
R6154:Clcn7 UTSW 17 25,376,928 (GRCm39) missense probably damaging 0.98
R6181:Clcn7 UTSW 17 25,370,702 (GRCm39) missense possibly damaging 0.79
R6306:Clcn7 UTSW 17 25,376,502 (GRCm39) missense probably benign 0.01
R6798:Clcn7 UTSW 17 25,378,734 (GRCm39) missense probably damaging 1.00
R6961:Clcn7 UTSW 17 25,376,188 (GRCm39) missense probably damaging 1.00
R7020:Clcn7 UTSW 17 25,365,325 (GRCm39) missense possibly damaging 0.76
R7089:Clcn7 UTSW 17 25,372,667 (GRCm39) missense
R7757:Clcn7 UTSW 17 25,375,796 (GRCm39) missense probably damaging 1.00
R8057:Clcn7 UTSW 17 25,368,233 (GRCm39) nonsense probably null
R9031:Clcn7 UTSW 17 25,376,497 (GRCm39) missense probably damaging 0.96
R9720:Clcn7 UTSW 17 25,374,471 (GRCm39) missense probably damaging 1.00
X0020:Clcn7 UTSW 17 25,369,200 (GRCm39) missense probably damaging 1.00
Z1177:Clcn7 UTSW 17 25,371,989 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGATTGGCCAAAGTTTCCCAC -3'
(R):5'- AACTCCTCTGGGTCTGTAAGTAC -3'

Sequencing Primer
(F):5'- AGTTTCCCACTGCAATCTCAAGG -3'
(R):5'- GTCTGTAAGTACCTGAGGCAC -3'
Posted On 2021-03-08