Mutagenetix > Incidental Mutations

Incidental Mutation 'R0238:Htr3a'

66113

Institutional Source

Beutler Lab

Gene Symbol

Htr3a

Ensembl Gene

ENSMUSG00000032269

Gene Name

5-hydroxytryptamine (serotonin) receptor 3A

Synonyms

5-HT3 receptor

MMRRC Submission

038476-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0238 (G1)

Quality Score

129

Status

Not validated

Chromosome

Chromosomal Location

48899213-48911099 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 48906386 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 96 (T96A)

Ref Sequence

ENSEMBL: ENSMUSP00000003826 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003826] [ENSMUST00000217289]

Predicted Effect

probably benign
Transcript: ENSMUST00000003826
AA Change: T96A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000003826
Gene: ENSMUSG00000032269
AA Change: T96A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	25	36	N/A	INTRINSIC
Pfam:Neur_chan_LBD	40	247	4.7e-57	PFAM
Pfam:Neur_chan_memb	254	480	1.8e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216896

Predicted Effect

probably benign
Transcript: ENSMUST00000217289
AA Change: T96A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

Meta Mutation Damage Score

0.1255

Coding Region Coverage

1x: 98.7%
3x: 97.4%
10x: 92.6%
20x: 76.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit A of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It appears that the heteromeric combination of A and B subunits is necessary to provide the full functional features of this receptor, since either subunit alone results in receptors with very low conductance and response amplitude. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display a decreased lifespan, cachexia, increased blood urea nitrogen, proteinuria, kidney inflammation, and a hyperdistended and neurogenic urinary bladder. Mice homozygous for a second null mutation display reduced chemical pain persistence responses but are otherwise healthy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aar2	T	G	2: 156,550,973	V94G	probably benign	Het
Acp5	A	T	9: 22,129,922	S70T	possibly damaging	Het
Adcy1	C	G	11: 7,139,162	N525K	possibly damaging	Het
AI464131	A	T	4: 41,498,912	N239K	probably benign	Het
Aknad1	A	G	3: 108,781,239	M628V	probably benign	Het
Alg8	A	T	7: 97,383,684		probably null	Het
Cacna1d	A	G	14: 30,123,496	V572A	probably benign	Het
Ccdc158	A	C	5: 92,662,118	M177R	probably benign	Het
Ccdc191	A	T	16: 43,947,496	R678*	probably null	Het
Cdkn2d	C	A	9: 21,290,992		probably benign	Het
Cdx2	G	T	5: 147,303,287	T193K	probably damaging	Het
Cfap44	T	A	16: 44,422,318	M695K	probably benign	Het
Cfap70	A	C	14: 20,448,605	S5A	probably benign	Het
Chd9	T	C	8: 90,932,828	S139P	probably damaging	Het
Chmp7	A	G	14: 69,720,997	V241A	probably damaging	Het
Cnga1	A	G	5: 72,605,031	I380T	probably damaging	Het
Cts6	T	A	13: 61,201,819	E53D	probably damaging	Het
Dclk3	A	T	9: 111,482,628	N646I	probably damaging	Het
Dnhd1	A	G	7: 105,721,531	S4673G	probably benign	Het
Dock4	G	T	12: 40,737,540	S818I	probably damaging	Het
Dysf	C	T	6: 84,064,479	Q156*	probably null	Het
Fam163b	T	C	2: 27,112,634	N117S	probably damaging	Het
Fam89a	A	G	8: 124,741,232	Y114H	probably damaging	Het
Flcn	T	C	11: 59,801,076	N249S	probably benign	Het
Gm20422	T	C	8: 69,766,715	Y53C	probably damaging	Het
Gnai1	A	G	5: 18,273,550	S206P	probably damaging	Het
Hal	T	C	10: 93,503,482	S478P	possibly damaging	Het
Haus3	G	A	5: 34,166,256	P337S	possibly damaging	Het
Hectd1	T	A	12: 51,769,318	M1324L	possibly damaging	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Hspa9	A	T	18: 34,946,646	Y243*	probably null	Het
Ift140	C	A	17: 25,045,523	C557*	probably null	Het
Jph3	A	G	8: 121,753,720	Q379R	possibly damaging	Het
Kcnb1	A	G	2: 167,104,969	V653A	probably benign	Het
Kif14	A	G	1: 136,527,393	E1551G	probably damaging	Het
Krt17	G	A	11: 100,260,878	R30*	probably null	Het
Lamb3	A	T	1: 193,321,053	D100V	probably damaging	Het
Map2	A	G	1: 66,416,106	D1385G	probably damaging	Het
Map3k21	A	G	8: 125,944,970	D999G	possibly damaging	Het
Marf1	T	C	16: 14,151,283	I109V	probably benign	Het
Mcam	T	G	9: 44,140,205		probably null	Het
Med18	T	C	4: 132,460,026	H99R	probably damaging	Het
Mettl25	C	T	10: 105,826,525	V195I	probably damaging	Het
Myh8	A	G	11: 67,301,692	T1466A	probably benign	Het
Myo1e	A	T	9: 70,342,126	I503F	possibly damaging	Het
Myo3b	T	A	2: 70,105,425	C61S	probably benign	Het
Nf1	A	T	11: 79,418,574	K438M	possibly damaging	Het
Nlrp9c	A	G	7: 26,378,012	S727P	possibly damaging	Het
Nmbr	C	T	10: 14,770,395	Q338*	probably null	Het
Nt5e	A	G	9: 88,367,332	S440G	possibly damaging	Het
Nubp2	T	C	17: 24,884,471	E144G	probably damaging	Het
Olfr1126	T	C	2: 87,458,037	F291L	probably benign	Het
Olfr593	G	A	7: 103,212,726	V289M	possibly damaging	Het
Olfr694	A	G	7: 106,689,255	Y159H	probably benign	Het
Otogl	T	A	10: 107,806,696	N1291I	probably damaging	Het
Pa2g4	T	C	10: 128,563,642	K51R	probably benign	Het
Pcdhb12	A	G	18: 37,436,727	I309V	probably benign	Het
Pck1	T	G	2: 173,157,068	I373S	possibly damaging	Het
Pga5	A	G	19: 10,669,453	Y305H	probably damaging	Het
Plxnd1	G	T	6: 115,968,793	D906E	probably benign	Het
Ppfia4	T	C	1: 134,329,189	E98G	possibly damaging	Het
Rab39	G	A	9: 53,706,030	T29I	probably damaging	Het
Raet1e	C	A	10: 22,180,862	H112Q	possibly damaging	Het
Rars2	T	C	4: 34,645,838	Y252H	probably damaging	Het
Rars2	A	C	4: 34,656,030	Q421P	probably benign	Het
Rasa2	A	T	9: 96,568,407	D479E	probably damaging	Het
Rbl2	A	T	8: 91,106,507	T689S	probably damaging	Het
Rims4	C	T	2: 163,864,025	V230M	probably benign	Het
Skp2	A	C	15: 9,127,884		probably null	Het
Slc35f4	A	T	14: 49,304,256	I347N	possibly damaging	Het
Slc4a2	A	T	5: 24,436,274		probably null	Het
Slc52a3	T	C	2: 152,008,156	*461Q	probably null	Het
Slc6a1	G	A	6: 114,302,800	V142I	probably benign	Het
Susd5	A	G	9: 114,096,909	*620W	probably null	Het
Timm21	T	C	18: 84,947,666	N239S	probably damaging	Het
Tmem63c	T	C	12: 87,075,639	W404R	probably damaging	Het
Tnrc6b	A	G	15: 80,887,864	D1118G	probably damaging	Het
Traf2	G	C	2: 25,537,126	A71G	possibly damaging	Het
Trim54	A	G	5: 31,134,119	M195V	probably benign	Het
Trip11	C	T	12: 101,884,728	E741K	probably damaging	Het
Trp73	AGCTGCTGCTGCTGCTGCTG	AGCTGCTGCTGCTGCTG	4: 154,062,524		probably benign	Het
Trpm5	G	T	7: 143,082,958	T414N	probably damaging	Het
Vps51	G	T	19: 6,071,437	S185*	probably null	Het
Zfp329	G	T	7: 12,810,829	T256K	probably damaging	Het
Zfp729b	A	G	13: 67,591,903	Y748H	probably damaging	Het
Zfp777	T	C	6: 48,024,969	E773G	probably damaging	Het

Other mutations in Htr3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02314:Htr3a	APN	9	48904627	missense	probably damaging	0.99
R0238:Htr3a	UTSW	9	48906386	missense	probably benign	0.06
R0403:Htr3a	UTSW	9	48908659	missense	probably damaging	0.96
R0899:Htr3a	UTSW	9	48901452	missense	possibly damaging	0.78
R1749:Htr3a	UTSW	9	48900933	missense	probably damaging	1.00
R1903:Htr3a	UTSW	9	48906381	missense	probably damaging	1.00
R1942:Htr3a	UTSW	9	48908611	missense	probably damaging	1.00
R2218:Htr3a	UTSW	9	48908611	missense	probably damaging	1.00
R2394:Htr3a	UTSW	9	48906343	missense	probably benign	0.29
R2402:Htr3a	UTSW	9	48901495	missense	probably damaging	1.00
R3430:Htr3a	UTSW	9	48907388	missense	probably benign	0.35
R6042:Htr3a	UTSW	9	48904699	missense	probably damaging	0.99
R6395:Htr3a	UTSW	9	48900571	missense	probably benign	0.00
R6407:Htr3a	UTSW	9	48901055	nonsense	probably null
R7791:Htr3a	UTSW	9	48901575	missense	possibly damaging	0.79

Predicted Primers

Posted On

2013-08-19