Mutagenetix > Incidental Mutation

Incidental Mutation 'R8671:Eif2ak4'

661140

Institutional Source

Beutler Lab

Gene Symbol

Eif2ak4

Ensembl Gene

ENSMUSG00000005102

Gene Name

eukaryotic translation initiation factor 2 alpha kinase 4

Synonyms

GCN2

MMRRC Submission

Accession Numbers

MGI: 1353427

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8671 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118388618-118475234 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118422186 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 413 (D413G)

Ref Sequence

ENSEMBL: ENSMUSP00000005233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000102527] [ENSMUST00000110870] [ENSMUST00000110872] [ENSMUST00000110874] [ENSMUST00000110877]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005233
AA Change: D413G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102
AA Change: D413G

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
RWD	25	137	3.42e-38	SMART
coiled coil region	146	205	N/A	INTRINSIC
Pfam:Pkinase	323	538	4.6e-27	PFAM
Pfam:Pkinase_Tyr	326	535	5.5e-18	PFAM
Pfam:Pkinase	589	663	1.7e-11	PFAM
Pfam:Pkinase_Tyr	589	663	1.2e-5	PFAM
low complexity region	728	738	N/A	INTRINSIC
Pfam:Pkinase	781	1000	2.6e-38	PFAM
Pfam:Pkinase_Tyr	786	998	1.8e-18	PFAM
Pfam:tRNA-synt_His	1054	1380	5.7e-18	PFAM
Pfam:HGTP_anticodon2	1392	1647	5.8e-17	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102527
AA Change: D301G

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102
AA Change: D301G

Domain	Start	End	E-Value	Type
coiled coil region	34	93	N/A	INTRINSIC
Pfam:Pkinase	211	426	1.6e-22	PFAM
Pfam:Pkinase_Tyr	215	423	6.8e-18	PFAM
Pfam:Pkinase_Tyr	477	551	1.2e-5	PFAM
Pfam:Pkinase	477	552	3.9e-11	PFAM
low complexity region	616	626	N/A	INTRINSIC
Pfam:Pkinase	647	888	9.4e-42	PFAM
Pfam:Pkinase_Tyr	672	886	1.4e-19	PFAM
Pfam:tRNA-synt_His	941	1268	4.8e-19	PFAM
Pfam:HGTP_anticodon2	1280	1535	1e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110870
AA Change: D135G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000106494
Gene: ENSMUSG00000005102
AA Change: D135G

Domain	Start	End	E-Value	Type
Pfam:Pkinase	45	260	3.3e-22	PFAM
Pfam:Pkinase_Tyr	47	257	1.3e-17	PFAM
Pfam:Pkinase_Tyr	311	385	2.5e-5	PFAM
Pfam:Pkinase	311	386	8e-11	PFAM
low complexity region	450	460	N/A	INTRINSIC
Pfam:Pkinase	481	722	1.9e-41	PFAM
Pfam:Pkinase_Tyr	506	720	2.8e-19	PFAM
Pfam:tRNA-synt_His	775	1102	8.7e-19	PFAM
Pfam:HGTP_anticodon2	1114	1369	1.9e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110872
AA Change: D292G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102
AA Change: D292G

Domain	Start	End	E-Value	Type
coiled coil region	25	84	N/A	INTRINSIC
Pfam:Pkinase	202	417	3.8e-22	PFAM
Pfam:Pkinase_Tyr	206	414	1.6e-17	PFAM
Pfam:Pkinase_Tyr	468	542	2.8e-5	PFAM
Pfam:Pkinase	468	543	9.1e-11	PFAM
low complexity region	607	617	N/A	INTRINSIC
Pfam:Pkinase	638	879	2.2e-41	PFAM
Pfam:Pkinase_Tyr	663	877	3.3e-19	PFAM
Pfam:tRNA-synt_His	932	1259	1.1e-18	PFAM
Pfam:HGTP_anticodon2	1271	1526	2.2e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110874
AA Change: D335G

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102
AA Change: D335G

Domain	Start	End	E-Value	Type
Pfam:RWD	8	56	6.4e-8	PFAM
coiled coil region	68	127	N/A	INTRINSIC
Pfam:Pkinase	245	460	1.1e-22	PFAM
Pfam:Pkinase_Tyr	247	457	4.2e-18	PFAM
Pfam:Pkinase_Tyr	511	585	7.8e-6	PFAM
Pfam:Pkinase	511	586	2.5e-11	PFAM
low complexity region	650	660	N/A	INTRINSIC
Pfam:Pkinase	681	922	6.2e-42	PFAM
Pfam:Pkinase_Tyr	706	920	9.3e-20	PFAM
Pfam:tRNA-synt_His	975	1302	3.8e-19	PFAM
Pfam:HGTP_anticodon2	1314	1569	5.4e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110877
AA Change: D413G

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000106501
Gene: ENSMUSG00000005102
AA Change: D413G

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
RWD	25	137	3.42e-38	SMART
coiled coil region	146	205	N/A	INTRINSIC
Pfam:Pkinase	323	538	2.6e-23	PFAM
Pfam:Pkinase_Tyr	327	535	1.1e-18	PFAM

Meta Mutation Damage Score

0.0936

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a null allele have altered feeding behavior, synaptic plasticity and dendritic cell function. Homozygotes for another null allele show enhanced muscle loss and morbidity after amino acid deprivation. Homozygotes for an ENU-induced allele show higher susceptibility to viral infection. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(4) Chemically induced(1)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	C	T	4: 73,942,929	E145K	probably damaging	Het
4930430A15Rik	T	C	2: 111,229,532		probably benign	Het
4930467E23Rik	T	A	8: 19,734,759	L203*	probably null	Het
Ambp	A	T	4: 63,150,419	Y120*	probably null	Het
Ankrd36	C	T	11: 5,629,312	A192V	probably benign	Het
Apol7e	A	T	15: 77,717,603	M134L	probably benign	Het
Atg9b	A	T	5: 24,386,109	N774K	probably benign	Het
BC027072	G	T	17: 71,751,377	A435E	probably benign	Het
Catsperb	T	A	12: 101,594,337	N862K	possibly damaging	Het
Ccdc7a	T	A	8: 128,920,467	D648V	probably damaging	Het
Cfap54	G	T	10: 92,955,072	P1855T	unknown	Het
Clcnkb	T	A	4: 141,412,230	T154S	probably damaging	Het
Cux1	C	T	5: 136,250,600	R609H	probably damaging	Het
Flnc	T	C	6: 29,443,502		probably null	Het
Grm5	T	C	7: 88,116,290		probably null	Het
Hectd3	T	G	4: 116,996,581	F225V	possibly damaging	Het
Hpcal4	G	T	4: 123,189,183	M107I	probably benign	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ikbkap	A	G	4: 56,771,453	L948P	probably damaging	Het
Larp4	C	A	15: 100,010,458	Q607K	probably benign	Het
March8	A	G	6: 116,401,854	R250G	probably benign	Het
Med13	A	C	11: 86,271,097	N2135K	probably damaging	Het
Msh5	T	A	17: 35,045,933	R89*	probably null	Het
Musk	T	G	4: 58,286,051		probably benign	Het
Myo18b	T	C	5: 112,874,743	Q261R	unknown	Het
Npr1	A	T	3: 90,456,157		probably benign	Het
Nynrin	T	A	14: 55,870,442	V1002E	possibly damaging	Het
Olfr1138	A	T	2: 87,737,646	L226Q	probably damaging	Het
Olfr1195	A	T	2: 88,683,105	F209Y	probably benign	Het
Olfr1315-ps1	T	A	2: 112,110,988	K88M	probably damaging	Het
Olfr167	T	C	16: 19,515,054	Y194C	possibly damaging	Het
Pcdh9	T	C	14: 93,888,650	Y28C	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Prkd1	T	A	12: 50,388,408	N512I	probably benign	Het
Pwwp2b	C	T	7: 139,256,410	P589L	probably damaging	Het
Rasgrp4	G	A	7: 29,143,027	G242D	probably damaging	Het
Rcbtb1	T	G	14: 59,230,524	V480G	probably damaging	Het
Rptn	A	G	3: 93,398,194	S945G	probably benign	Het
Slc22a2	C	T	17: 12,605,976	Q242*	probably null	Het
Slfn3	T	A	11: 83,212,999	V232E	probably benign	Het
Stab1	T	A	14: 31,157,408	K705M	probably damaging	Het
Syn2	C	A	6: 115,278,167	S480*	probably null	Het
Thsd4	A	T	9: 60,394,445	L189H	probably damaging	Het
Tinagl1	T	C	4: 130,167,804	T250A	probably benign	Het
Tnc	A	T	4: 64,017,446	C418S	probably damaging	Het
Ube2q1	A	G	3: 89,776,078	E110G	probably damaging	Het
Wdfy4	G	T	14: 32,971,765		probably benign	Het
Xcl1	T	C	1: 164,931,850	M94V	probably benign	Het
Zfp369	T	C	13: 65,296,281	S413P	possibly damaging	Het
Zfp454	A	C	11: 50,873,768	I279S	possibly damaging	Het
Zfp971	A	C	2: 178,033,937	Q443P	probably damaging	Het

Other mutations in Eif2ak4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Eif2ak4	APN	2	118464055	missense	probably damaging	1.00
IGL00806:Eif2ak4	APN	2	118441166	missense	probably benign	0.08
IGL01343:Eif2ak4	APN	2	118422089	missense	probably benign	0.00
IGL01796:Eif2ak4	APN	2	118446304	missense	probably benign	0.10
IGL02263:Eif2ak4	APN	2	118461778	missense	probably benign	0.00
IGL02391:Eif2ak4	APN	2	118420791	missense	probably benign	0.19
IGL02516:Eif2ak4	APN	2	118436254	missense	probably damaging	1.00
IGL02603:Eif2ak4	APN	2	118450326	missense	probably damaging	1.00
IGL02731:Eif2ak4	APN	2	118388814	missense	probably benign
IGL02928:Eif2ak4	APN	2	118472687	critical splice donor site	probably null
IGL02947:Eif2ak4	APN	2	118431033	missense	probably benign	0.00
IGL03191:Eif2ak4	APN	2	118422212	missense	probably damaging	1.00
IGL03202:Eif2ak4	APN	2	118400620	missense	probably damaging	1.00
IGL03235:Eif2ak4	APN	2	118443140	missense	probably damaging	1.00
IGL03375:Eif2ak4	APN	2	118422318	missense	probably benign	0.08
absurdum	UTSW	2	118420810	nonsense	probably null
Ad	UTSW	2	118436241	missense	probably damaging	1.00
atchoum	UTSW	2	118400653	splice site	probably benign
reductio	UTSW	2	118436158	splice site	probably null
PIT4520001:Eif2ak4	UTSW	2	118462327	missense	probably damaging	1.00
R0023:Eif2ak4	UTSW	2	118462721	missense	probably damaging	1.00
R0358:Eif2ak4	UTSW	2	118463929	splice site	probably null
R0482:Eif2ak4	UTSW	2	118462347	missense	probably damaging	1.00
R0505:Eif2ak4	UTSW	2	118431036	missense	probably benign	0.01
R0523:Eif2ak4	UTSW	2	118442096	critical splice donor site	probably null
R0578:Eif2ak4	UTSW	2	118474991	splice site	probably benign
R0615:Eif2ak4	UTSW	2	118436185	missense	probably damaging	1.00
R1300:Eif2ak4	UTSW	2	118463983	missense	possibly damaging	0.79
R1531:Eif2ak4	UTSW	2	118443210	missense	probably damaging	1.00
R1777:Eif2ak4	UTSW	2	118430839	missense	probably damaging	0.98
R1866:Eif2ak4	UTSW	2	118472661	missense	probably damaging	1.00
R1932:Eif2ak4	UTSW	2	118448486	missense	probably damaging	1.00
R1977:Eif2ak4	UTSW	2	118461757	nonsense	probably null
R2011:Eif2ak4	UTSW	2	118430947	missense	probably damaging	1.00
R2046:Eif2ak4	UTSW	2	118451408	splice site	probably benign
R2122:Eif2ak4	UTSW	2	118455793	missense	probably damaging	1.00
R2125:Eif2ak4	UTSW	2	118422123	missense	probably benign	0.02
R2126:Eif2ak4	UTSW	2	118422123	missense	probably benign	0.02
R2193:Eif2ak4	UTSW	2	118422266	missense	probably benign	0.12
R2259:Eif2ak4	UTSW	2	118455783	missense	probably damaging	0.97
R2513:Eif2ak4	UTSW	2	118426583	missense	probably damaging	1.00
R3798:Eif2ak4	UTSW	2	118474083	missense	probably damaging	1.00
R3898:Eif2ak4	UTSW	2	118430923	missense	probably damaging	1.00
R3900:Eif2ak4	UTSW	2	118475029	missense	probably damaging	1.00
R4375:Eif2ak4	UTSW	2	118427924	missense	probably damaging	1.00
R4423:Eif2ak4	UTSW	2	118439066	missense	probably benign	0.01
R4589:Eif2ak4	UTSW	2	118417338	missense	probably damaging	1.00
R4734:Eif2ak4	UTSW	2	118422087	missense	probably damaging	1.00
R5173:Eif2ak4	UTSW	2	118408360	missense	probably damaging	1.00
R5367:Eif2ak4	UTSW	2	118436158	splice site	probably null
R5471:Eif2ak4	UTSW	2	118474132	missense	probably benign	0.02
R5528:Eif2ak4	UTSW	2	118427938	missense	probably damaging	1.00
R5634:Eif2ak4	UTSW	2	118462311	missense	probably damaging	1.00
R5726:Eif2ak4	UTSW	2	118443132	missense	probably damaging	1.00
R5756:Eif2ak4	UTSW	2	118462740	missense	possibly damaging	0.95
R5779:Eif2ak4	UTSW	2	118412963	missense	possibly damaging	0.85
R5807:Eif2ak4	UTSW	2	118388851	missense	probably benign
R6045:Eif2ak4	UTSW	2	118388815	nonsense	probably null
R6187:Eif2ak4	UTSW	2	118457157	missense	probably damaging	0.98
R6193:Eif2ak4	UTSW	2	118400600	start gained	probably benign
R6468:Eif2ak4	UTSW	2	118436241	missense	probably damaging	1.00
R6555:Eif2ak4	UTSW	2	118427869	missense	probably damaging	0.96
R6616:Eif2ak4	UTSW	2	118454845	nonsense	probably null
R6737:Eif2ak4	UTSW	2	118462268	frame shift	probably null
R6956:Eif2ak4	UTSW	2	118422267	missense	probably damaging	0.96
R7075:Eif2ak4	UTSW	2	118420810	nonsense	probably null
R7109:Eif2ak4	UTSW	2	118405051	missense	probably damaging	1.00
R7228:Eif2ak4	UTSW	2	118457157	missense	probably damaging	0.98
R7441:Eif2ak4	UTSW	2	118471896	missense	probably benign	0.01
R7555:Eif2ak4	UTSW	2	118417283	missense	possibly damaging	0.64
R7567:Eif2ak4	UTSW	2	118450314	missense	probably benign
R8004:Eif2ak4	UTSW	2	118417294	missense	possibly damaging	0.64
R8063:Eif2ak4	UTSW	2	118410901	missense	possibly damaging	0.94
R8092:Eif2ak4	UTSW	2	118442032	missense	probably damaging	1.00
R8195:Eif2ak4	UTSW	2	118450338	missense	possibly damaging	0.50
R8306:Eif2ak4	UTSW	2	118457175	missense	possibly damaging	0.68
R8470:Eif2ak4	UTSW	2	118462726	missense	probably damaging	0.98
R8693:Eif2ak4	UTSW	2	118432237	missense	probably damaging	0.98
R8714:Eif2ak4	UTSW	2	118462284	missense	possibly damaging	0.89
R8744:Eif2ak4	UTSW	2	118430993	nonsense	probably null
R8813:Eif2ak4	UTSW	2	118448325	missense	probably damaging	1.00
R8917:Eif2ak4	UTSW	2	118457136	missense	probably damaging	1.00
R8924:Eif2ak4	UTSW	2	118428032	missense	probably damaging	1.00
R9177:Eif2ak4	UTSW	2	118441220	critical splice donor site	probably null
R9189:Eif2ak4	UTSW	2	118427912	missense	probably damaging	1.00
R9231:Eif2ak4	UTSW	2	118441181	missense	probably benign	0.00
R9268:Eif2ak4	UTSW	2	118441220	critical splice donor site	probably null
R9321:Eif2ak4	UTSW	2	118462317	missense	possibly damaging	0.93
R9512:Eif2ak4	UTSW	2	118462715	missense	probably damaging	1.00
R9569:Eif2ak4	UTSW	2	118420835	missense	probably benign	0.00
R9658:Eif2ak4	UTSW	2	118439030	missense	probably damaging	1.00
R9748:Eif2ak4	UTSW	2	118417249	missense	probably benign	0.01
R9757:Eif2ak4	UTSW	2	118438917	missense	probably benign	0.02
R9766:Eif2ak4	UTSW	2	118430832	nonsense	probably null
X0061:Eif2ak4	UTSW	2	118468176	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCTACTCAGATTCAAGGAGC -3'
(R):5'- GCAGGGCACTGTCACTAAAAC -3'

Sequencing Primer
(F):5'- TTCAGCTCCCTAGTGAAACTGAG -3'
(R):5'- ACGAACTCGAGCTTGCTC -3'

Posted On

2021-03-08