Incidental Mutation 'R8671:Zfp971'
ID661141
Institutional Source Beutler Lab
Gene Symbol Zfp971
Ensembl Gene ENSMUSG00000074519
Gene Namezinc finger protein 971
SynonymsEtohi1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8671 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location178023284-178034022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 178033937 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 443 (Q443P)
Ref Sequence ENSEMBL: ENSMUSP00000104554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108925] [ENSMUST00000108926]
Predicted Effect probably benign
Transcript: ENSMUST00000108925
SMART Domains Protein: ENSMUSP00000104553
Gene: ENSMUSG00000074519

DomainStartEndE-ValueType
KRAB 4 64 1.2e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108926
AA Change: Q443P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104554
Gene: ENSMUSG00000074519
AA Change: Q443P

DomainStartEndE-ValueType
KRAB 4 66 1.6e-13 SMART
ZnF_C2H2 78 97 1.38e2 SMART
ZnF_C2H2 103 125 4.38e1 SMART
ZnF_C2H2 131 153 1.92e-2 SMART
ZnF_C2H2 159 181 4.79e-3 SMART
ZnF_C2H2 187 209 2.36e-2 SMART
ZnF_C2H2 215 237 2.36e-2 SMART
ZnF_C2H2 243 265 3.69e-4 SMART
ZnF_C2H2 271 293 4.87e-4 SMART
ZnF_C2H2 299 321 4.4e-2 SMART
ZnF_C2H2 327 349 4.61e-5 SMART
ZnF_C2H2 355 377 4.94e-5 SMART
ZnF_C2H2 383 405 3.21e-4 SMART
ZnF_C2H2 411 433 4.47e-3 SMART
ZnF_C2H2 439 461 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,942,929 E145K probably damaging Het
4930430A15Rik T C 2: 111,229,532 probably benign Het
4930467E23Rik T A 8: 19,734,759 L203* probably null Het
Ambp A T 4: 63,150,419 Y120* probably null Het
Ankrd36 C T 11: 5,629,312 A192V probably benign Het
Apol7e A T 15: 77,717,603 M134L probably benign Het
Atg9b A T 5: 24,386,109 N774K probably benign Het
BC027072 G T 17: 71,751,377 A435E probably benign Het
Catsperb T A 12: 101,594,337 N862K possibly damaging Het
Ccdc7a T A 8: 128,920,467 D648V probably damaging Het
Cfap54 G T 10: 92,955,072 P1855T unknown Het
Clcnkb T A 4: 141,412,230 T154S probably damaging Het
Cux1 C T 5: 136,250,600 R609H probably damaging Het
Eif2ak4 A G 2: 118,422,186 D413G possibly damaging Het
Flnc T C 6: 29,443,502 probably null Het
Grm5 T C 7: 88,116,290 probably null Het
Hectd3 T G 4: 116,996,581 F225V possibly damaging Het
Hpcal4 G T 4: 123,189,183 M107I probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ikbkap A G 4: 56,771,453 L948P probably damaging Het
Larp4 C A 15: 100,010,458 Q607K probably benign Het
March8 A G 6: 116,401,854 R250G probably benign Het
Med13 A C 11: 86,271,097 N2135K probably damaging Het
Msh5 T A 17: 35,045,933 R89* probably null Het
Musk T G 4: 58,286,051 probably benign Het
Myo18b T C 5: 112,874,743 Q261R unknown Het
Npr1 A T 3: 90,456,157 probably benign Het
Nynrin T A 14: 55,870,442 V1002E possibly damaging Het
Olfr1138 A T 2: 87,737,646 L226Q probably damaging Het
Olfr1195 A T 2: 88,683,105 F209Y probably benign Het
Olfr1315-ps1 T A 2: 112,110,988 K88M probably damaging Het
Olfr167 T C 16: 19,515,054 Y194C possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prkd1 T A 12: 50,388,408 N512I probably benign Het
Pwwp2b C T 7: 139,256,410 P589L probably damaging Het
Rasgrp4 G A 7: 29,143,027 G242D probably damaging Het
Rcbtb1 T G 14: 59,230,524 V480G probably damaging Het
Rptn A G 3: 93,398,194 S945G probably benign Het
Slc22a2 C T 17: 12,605,976 Q242* probably null Het
Slfn3 T A 11: 83,212,999 V232E probably benign Het
Stab1 T A 14: 31,157,408 K705M probably damaging Het
Syn2 C A 6: 115,278,167 S480* probably null Het
Thsd4 A T 9: 60,394,445 L189H probably damaging Het
Tinagl1 T C 4: 130,167,804 T250A probably benign Het
Tnc A T 4: 64,017,446 C418S probably damaging Het
Ube2q1 A G 3: 89,776,078 E110G probably damaging Het
Wdfy4 G T 14: 32,971,765 probably benign Het
Xcl1 T C 1: 164,931,850 M94V probably benign Het
Zfp369 T C 13: 65,296,281 S413P possibly damaging Het
Zfp454 A C 11: 50,873,768 I279S possibly damaging Het
Other mutations in Zfp971
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Zfp971 APN 2 178023382 critical splice donor site probably null
R1108:Zfp971 UTSW 2 178033670 missense probably damaging 1.00
R1759:Zfp971 UTSW 2 178033929 missense probably damaging 0.99
R2183:Zfp971 UTSW 2 178033740 missense probably damaging 1.00
R2343:Zfp971 UTSW 2 178032994 missense possibly damaging 0.84
R4873:Zfp971 UTSW 2 178033147 missense probably benign 0.24
R4875:Zfp971 UTSW 2 178033147 missense probably benign 0.24
R5263:Zfp971 UTSW 2 178033762 missense probably damaging 1.00
R5396:Zfp971 UTSW 2 178033733 missense probably damaging 1.00
R6150:Zfp971 UTSW 2 178033454 missense probably benign 0.26
R6693:Zfp971 UTSW 2 178033431 missense probably benign 0.01
R6811:Zfp971 UTSW 2 178033881 missense possibly damaging 0.62
R7427:Zfp971 UTSW 2 178033174 missense probably damaging 1.00
R7428:Zfp971 UTSW 2 178033174 missense probably damaging 1.00
R7594:Zfp971 UTSW 2 178034000 missense possibly damaging 0.47
R7790:Zfp971 UTSW 2 178033499 missense probably damaging 0.96
R7796:Zfp971 UTSW 2 178031610 missense probably benign 0.00
R7934:Zfp971 UTSW 2 178033380 missense probably benign
R7990:Zfp971 UTSW 2 178033568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTGGTAAAGCCTTTGCAG -3'
(R):5'- AGGTCACTCCTTACTGCAAAG -3'

Sequencing Primer
(F):5'- TGTGGTAAAGCCTTTGCAGAAAGC -3'
(R):5'- GAACACTGCTTCCTTCAAAGGG -3'
Posted On2021-03-08