Mutagenetix > Incidental Mutation

Incidental Mutation 'R8671:Rptn'

661143

Institutional Source

Beutler Lab

Gene Symbol

Rptn

Ensembl Gene

ENSMUSG00000041984

Gene Name

repetin

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_009100; MGI: 1099055

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R8671 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93393699-93399442 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93398194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 945 (S945G)

Ref Sequence

ENSEMBL: ENSMUSP00000044998 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045912]

AlphaFold

P97347

Predicted Effect

probably benign
Transcript: ENSMUST00000045912
AA Change: S945G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000044998
Gene: ENSMUSG00000041984
AA Change: S945G

Domain	Start	End	E-Value	Type
Pfam:S_100	4	46	3.2e-13	PFAM
Blast:EFh	53	81	5e-10	BLAST
low complexity region	189	204	N/A	INTRINSIC
low complexity region	237	252	N/A	INTRINSIC
Blast:CTD	318	461	1e-7	BLAST
low complexity region	1007	1041	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (48/48)

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	C	T	4: 73,942,929	E145K	probably damaging	Het
4930430A15Rik	T	C	2: 111,229,532		probably benign	Het
4930467E23Rik	T	A	8: 19,734,759	L203*	probably null	Het
Ambp	A	T	4: 63,150,419	Y120*	probably null	Het
Ankrd36	C	T	11: 5,629,312	A192V	probably benign	Het
Apol7e	A	T	15: 77,717,603	M134L	probably benign	Het
Atg9b	A	T	5: 24,386,109	N774K	probably benign	Het
BC027072	G	T	17: 71,751,377	A435E	probably benign	Het
Catsperb	T	A	12: 101,594,337	N862K	possibly damaging	Het
Ccdc7a	T	A	8: 128,920,467	D648V	probably damaging	Het
Cfap54	G	T	10: 92,955,072	P1855T	unknown	Het
Clcnkb	T	A	4: 141,412,230	T154S	probably damaging	Het
Cux1	C	T	5: 136,250,600	R609H	probably damaging	Het
Eif2ak4	A	G	2: 118,422,186	D413G	possibly damaging	Het
Flnc	T	C	6: 29,443,502		probably null	Het
Grm5	T	C	7: 88,116,290		probably null	Het
Hectd3	T	G	4: 116,996,581	F225V	possibly damaging	Het
Hpcal4	G	T	4: 123,189,183	M107I	probably benign	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ikbkap	A	G	4: 56,771,453	L948P	probably damaging	Het
Larp4	C	A	15: 100,010,458	Q607K	probably benign	Het
March8	A	G	6: 116,401,854	R250G	probably benign	Het
Med13	A	C	11: 86,271,097	N2135K	probably damaging	Het
Msh5	T	A	17: 35,045,933	R89*	probably null	Het
Musk	T	G	4: 58,286,051		probably benign	Het
Myo18b	T	C	5: 112,874,743	Q261R	unknown	Het
Npr1	A	T	3: 90,456,157		probably benign	Het
Nynrin	T	A	14: 55,870,442	V1002E	possibly damaging	Het
Olfr1138	A	T	2: 87,737,646	L226Q	probably damaging	Het
Olfr1195	A	T	2: 88,683,105	F209Y	probably benign	Het
Olfr1315-ps1	T	A	2: 112,110,988	K88M	probably damaging	Het
Olfr167	T	C	16: 19,515,054	Y194C	possibly damaging	Het
Pcdh9	T	C	14: 93,888,650	Y28C	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Prkd1	T	A	12: 50,388,408	N512I	probably benign	Het
Pwwp2b	C	T	7: 139,256,410	P589L	probably damaging	Het
Rasgrp4	G	A	7: 29,143,027	G242D	probably damaging	Het
Rcbtb1	T	G	14: 59,230,524	V480G	probably damaging	Het
Slc22a2	C	T	17: 12,605,976	Q242*	probably null	Het
Slfn3	T	A	11: 83,212,999	V232E	probably benign	Het
Stab1	T	A	14: 31,157,408	K705M	probably damaging	Het
Syn2	C	A	6: 115,278,167	S480*	probably null	Het
Thsd4	A	T	9: 60,394,445	L189H	probably damaging	Het
Tinagl1	T	C	4: 130,167,804	T250A	probably benign	Het
Tnc	A	T	4: 64,017,446	C418S	probably damaging	Het
Ube2q1	A	G	3: 89,776,078	E110G	probably damaging	Het
Wdfy4	G	T	14: 32,971,765		probably benign	Het
Xcl1	T	C	1: 164,931,850	M94V	probably benign	Het
Zfp369	T	C	13: 65,296,281	S413P	possibly damaging	Het
Zfp454	A	C	11: 50,873,768	I279S	possibly damaging	Het
Zfp971	A	C	2: 178,033,937	Q443P	probably damaging	Het

Other mutations in Rptn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01062:Rptn	APN	3	93397182	missense	probably benign
IGL01070:Rptn	APN	3	93398176	missense	possibly damaging	0.86
IGL01625:Rptn	APN	3	93397894	missense	probably benign	0.18
IGL01678:Rptn	APN	3	93396811	missense	probably benign	0.00
IGL01716:Rptn	APN	3	93396710	missense	possibly damaging	0.53
IGL01767:Rptn	APN	3	93395639	missense	probably benign	0.00
IGL01872:Rptn	APN	3	93396847	missense	probably benign
IGL02000:Rptn	APN	3	93396428	missense	probably benign	0.01
IGL02066:Rptn	APN	3	93397129	missense	probably benign	0.01
IGL02090:Rptn	APN	3	93396734	missense	possibly damaging	0.85
IGL02116:Rptn	APN	3	93395097	missense	possibly damaging	0.88
IGL02216:Rptn	APN	3	93395773	missense	possibly damaging	0.73
IGL02368:Rptn	APN	3	93397171	missense	probably benign	0.18
IGL02820:Rptn	APN	3	93396920	missense	probably benign	0.01
IGL03323:Rptn	APN	3	93397153	missense	probably benign
IGL03404:Rptn	APN	3	93398129	missense	possibly damaging	0.53
D3080:Rptn	UTSW	3	93395828	missense	possibly damaging	0.85
H8786:Rptn	UTSW	3	93397873	missense	possibly damaging	0.53
IGL03097:Rptn	UTSW	3	93397373	missense	probably damaging	1.00
LCD18:Rptn	UTSW	3	93397541	missense	probably benign
PIT4431001:Rptn	UTSW	3	93397397	small deletion	probably benign
PIT4480001:Rptn	UTSW	3	93397670	missense	possibly damaging	0.85
R1024:Rptn	UTSW	3	93398225	missense	possibly damaging	0.72
R1119:Rptn	UTSW	3	93396245	missense	possibly damaging	0.96
R1727:Rptn	UTSW	3	93397138	missense	possibly damaging	0.73
R1901:Rptn	UTSW	3	93396710	missense	possibly damaging	0.53
R2247:Rptn	UTSW	3	93396829	missense	probably benign
R2921:Rptn	UTSW	3	93398708	missense	possibly damaging	0.96
R2922:Rptn	UTSW	3	93398708	missense	possibly damaging	0.96
R2923:Rptn	UTSW	3	93398708	missense	possibly damaging	0.96
R3901:Rptn	UTSW	3	93398357	missense	probably benign
R3936:Rptn	UTSW	3	93395576	missense	possibly damaging	0.79
R4304:Rptn	UTSW	3	93396931	missense	probably benign	0.33
R4491:Rptn	UTSW	3	93396511	nonsense	probably null
R4654:Rptn	UTSW	3	93397485	missense	possibly damaging	0.53
R4870:Rptn	UTSW	3	93396469	nonsense	probably null
R5246:Rptn	UTSW	3	93396833	missense	probably damaging	0.98
R5246:Rptn	UTSW	3	93397729	missense	possibly damaging	0.53
R5544:Rptn	UTSW	3	93398473	missense	possibly damaging	0.53
R5555:Rptn	UTSW	3	93396701	missense	probably benign
R5896:Rptn	UTSW	3	93398332	nonsense	probably null
R5956:Rptn	UTSW	3	93398027	missense	possibly damaging	0.53
R6192:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6209:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6224:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6226:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6227:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6230:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6247:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6258:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6393:Rptn	UTSW	3	93397199	missense	probably benign
R6513:Rptn	UTSW	3	93396112	missense	possibly damaging	0.73
R6854:Rptn	UTSW	3	93398123	missense	possibly damaging	0.53
R6855:Rptn	UTSW	3	93398251	missense	probably benign	0.33
R6884:Rptn	UTSW	3	93395789	missense	probably benign	0.33
R7018:Rptn	UTSW	3	93397900	missense	possibly damaging	0.73
R7241:Rptn	UTSW	3	93395954	missense	probably benign	0.01
R7337:Rptn	UTSW	3	93396905	missense	probably benign	0.03
R7754:Rptn	UTSW	3	93395921	missense	probably damaging	0.98
R7794:Rptn	UTSW	3	93395729	missense	probably benign
R7801:Rptn	UTSW	3	93398224	missense	possibly damaging	0.53
R8161:Rptn	UTSW	3	93396693	small deletion	probably benign
R8374:Rptn	UTSW	3	93396295	nonsense	probably null
R8804:Rptn	UTSW	3	93395843	missense	probably damaging	0.98
R8934:Rptn	UTSW	3	93395912	missense	probably benign	0.00
R8938:Rptn	UTSW	3	93395025	missense	possibly damaging	0.93
R9056:Rptn	UTSW	3	93397105	missense	probably benign	0.33
R9082:Rptn	UTSW	3	93395621	missense	possibly damaging	0.94
R9140:Rptn	UTSW	3	93396138	nonsense	probably null
R9310:Rptn	UTSW	3	93397077	missense	probably benign	0.00
R9392:Rptn	UTSW	3	93398414	missense	probably benign
R9403:Rptn	UTSW	3	93395042	missense	probably benign	0.17
R9564:Rptn	UTSW	3	93397229	missense	probably benign
R9748:Rptn	UTSW	3	93397454	missense	possibly damaging	0.85
X0018:Rptn	UTSW	3	93395941	nonsense	probably null
Z1088:Rptn	UTSW	3	93397427	missense	probably benign	0.01
Z1176:Rptn	UTSW	3	93395018	missense	probably benign	0.26
Z1177:Rptn	UTSW	3	93395643	nonsense	probably null
Z1177:Rptn	UTSW	3	93395712	missense	probably benign	0.01
Z1177:Rptn	UTSW	3	93397887	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- AGGGCAAAACAGGCACTCTC -3'
(R):5'- ATGTCTACCATGTTGATGATCGTG -3'

Sequencing Primer
(F):5'- GCACTCTCTAGGGACTGATAGAAC -3'
(R):5'- CTACCATGTTGATGATCGTGATTTTC -3'

Posted On

2021-03-08