Incidental Mutation 'R8671:2310002L09Rik'
ID 661148
Institutional Source Beutler Lab
Gene Symbol 2310002L09Rik
Ensembl Gene ENSMUSG00000028396
Gene Name RIKEN cDNA 2310002L09 gene
Synonyms
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 73857608-73869083 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 73861166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 145 (E145K)
Ref Sequence ENSEMBL: ENSMUSP00000092633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030101] [ENSMUST00000095023]
AlphaFold Q9D7L5
Predicted Effect probably damaging
Transcript: ENSMUST00000030101
AA Change: E145K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030101
Gene: ENSMUSG00000028396
AA Change: E145K

DomainStartEndE-ValueType
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095023
AA Change: E145K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092633
Gene: ENSMUSG00000028396
AA Change: E145K

DomainStartEndE-ValueType
transmembrane domain 174 196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in 2310002L09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:2310002L09Rik APN 4 73,860,956 (GRCm39) missense possibly damaging 0.66
IGL01366:2310002L09Rik APN 4 73,868,937 (GRCm39) utr 5 prime probably benign
IGL02596:2310002L09Rik APN 4 73,868,904 (GRCm39) missense possibly damaging 0.94
R0841:2310002L09Rik UTSW 4 73,860,986 (GRCm39) missense probably benign
R2919:2310002L09Rik UTSW 4 73,868,845 (GRCm39) missense probably damaging 1.00
R6056:2310002L09Rik UTSW 4 73,861,115 (GRCm39) missense probably benign 0.00
R6795:2310002L09Rik UTSW 4 73,869,065 (GRCm39) start gained probably benign
R6889:2310002L09Rik UTSW 4 73,861,290 (GRCm39) missense probably benign 0.19
R7709:2310002L09Rik UTSW 4 73,861,091 (GRCm39) missense possibly damaging 0.52
R7793:2310002L09Rik UTSW 4 73,861,172 (GRCm39) missense probably benign 0.05
R8517:2310002L09Rik UTSW 4 73,861,206 (GRCm39) missense probably damaging 1.00
R8867:2310002L09Rik UTSW 4 73,861,087 (GRCm39) missense probably damaging 1.00
R8938:2310002L09Rik UTSW 4 73,861,424 (GRCm39) missense probably damaging 1.00
R9618:2310002L09Rik UTSW 4 73,868,934 (GRCm39) start codon destroyed probably null 0.46
Predicted Primers PCR Primer
(F):5'- AATGTTGACCTTCCCAGTCACC -3'
(R):5'- TAGCGTATAACACCAGCGC -3'

Sequencing Primer
(F):5'- CCTTTAGAGGACGGTAGTATTCATAG -3'
(R):5'- TATAACACCAGCGCCAGCCTG -3'
Posted On 2021-03-08