Incidental Mutation 'R8671:Hectd3'
ID 661149
Institutional Source Beutler Lab
Gene Symbol Hectd3
Ensembl Gene ENSMUSG00000046861
Gene Name HECT domain E3 ubiquitin protein ligase 3
Synonyms 1700064K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 116995317-117005277 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 116996581 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 225 (F225V)
Ref Sequence ENSEMBL: ENSMUSP00000051922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030446] [ENSMUST00000050067] [ENSMUST00000130273]
AlphaFold Q3U487
Predicted Effect probably benign
Transcript: ENSMUST00000030446
SMART Domains Protein: ENSMUSP00000030446
Gene: ENSMUSG00000028684

DomainStartEndE-ValueType
Pfam:URO-D 14 360 2.4e-135 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000050067
AA Change: F225V

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051922
Gene: ENSMUSG00000046861
AA Change: F225V

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
APC10 237 391 6.75e-23 SMART
HECTc 514 857 1.27e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130273
SMART Domains Protein: ENSMUSP00000116154
Gene: ENSMUSG00000028684

DomainStartEndE-ValueType
Pfam:URO-D 1 64 1.2e-18 PFAM
Pfam:URO-D 60 120 4e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene transfers ubiquitin from an E2 ubiquitin-conjugating enzyme to targeted substrates, leading to the degradation of those substrates. The encoded protein has been shown to transfer ubiquitin to TRIOBP to facilitate cell cycle progression, and to STX8. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,942,929 E145K probably damaging Het
4930430A15Rik T C 2: 111,229,532 probably benign Het
4930467E23Rik T A 8: 19,734,759 L203* probably null Het
Ambp A T 4: 63,150,419 Y120* probably null Het
Ankrd36 C T 11: 5,629,312 A192V probably benign Het
Apol7e A T 15: 77,717,603 M134L probably benign Het
Atg9b A T 5: 24,386,109 N774K probably benign Het
BC027072 G T 17: 71,751,377 A435E probably benign Het
Catsperb T A 12: 101,594,337 N862K possibly damaging Het
Ccdc7a T A 8: 128,920,467 D648V probably damaging Het
Cfap54 G T 10: 92,955,072 P1855T unknown Het
Clcnkb T A 4: 141,412,230 T154S probably damaging Het
Cux1 C T 5: 136,250,600 R609H probably damaging Het
Eif2ak4 A G 2: 118,422,186 D413G possibly damaging Het
Flnc T C 6: 29,443,502 probably null Het
Grm5 T C 7: 88,116,290 probably null Het
Hpcal4 G T 4: 123,189,183 M107I probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ikbkap A G 4: 56,771,453 L948P probably damaging Het
Larp4 C A 15: 100,010,458 Q607K probably benign Het
March8 A G 6: 116,401,854 R250G probably benign Het
Med13 A C 11: 86,271,097 N2135K probably damaging Het
Msh5 T A 17: 35,045,933 R89* probably null Het
Musk T G 4: 58,286,051 probably benign Het
Myo18b T C 5: 112,874,743 Q261R unknown Het
Npr1 A T 3: 90,456,157 probably benign Het
Nynrin T A 14: 55,870,442 V1002E possibly damaging Het
Olfr1138 A T 2: 87,737,646 L226Q probably damaging Het
Olfr1195 A T 2: 88,683,105 F209Y probably benign Het
Olfr1315-ps1 T A 2: 112,110,988 K88M probably damaging Het
Olfr167 T C 16: 19,515,054 Y194C possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prkd1 T A 12: 50,388,408 N512I probably benign Het
Pwwp2b C T 7: 139,256,410 P589L probably damaging Het
Rasgrp4 G A 7: 29,143,027 G242D probably damaging Het
Rcbtb1 T G 14: 59,230,524 V480G probably damaging Het
Rptn A G 3: 93,398,194 S945G probably benign Het
Slc22a2 C T 17: 12,605,976 Q242* probably null Het
Slfn3 T A 11: 83,212,999 V232E probably benign Het
Stab1 T A 14: 31,157,408 K705M probably damaging Het
Syn2 C A 6: 115,278,167 S480* probably null Het
Thsd4 A T 9: 60,394,445 L189H probably damaging Het
Tinagl1 T C 4: 130,167,804 T250A probably benign Het
Tnc A T 4: 64,017,446 C418S probably damaging Het
Ube2q1 A G 3: 89,776,078 E110G probably damaging Het
Wdfy4 G T 14: 32,971,765 probably benign Het
Xcl1 T C 1: 164,931,850 M94V probably benign Het
Zfp369 T C 13: 65,296,281 S413P possibly damaging Het
Zfp454 A C 11: 50,873,768 I279S possibly damaging Het
Zfp971 A C 2: 178,033,937 Q443P probably damaging Het
Other mutations in Hectd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Hectd3 APN 4 117000588 splice site probably benign
IGL00227:Hectd3 APN 4 117000587 splice site probably benign
IGL00227:Hectd3 APN 4 117000589 splice site probably benign
IGL00987:Hectd3 APN 4 116999643 missense probably damaging 0.98
IGL01402:Hectd3 APN 4 116996065 missense probably damaging 0.96
IGL01660:Hectd3 APN 4 116996372 missense possibly damaging 0.91
IGL02397:Hectd3 APN 4 117003136 missense possibly damaging 0.94
IGL03029:Hectd3 APN 4 116996965 nonsense probably null
chopstix2 UTSW 4 116996396 missense probably benign 0.08
R0147:Hectd3 UTSW 4 116997040 unclassified probably benign
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0611:Hectd3 UTSW 4 116996044 missense possibly damaging 0.67
R1367:Hectd3 UTSW 4 116997170 missense probably null 0.48
R1401:Hectd3 UTSW 4 117002269 missense possibly damaging 0.52
R1444:Hectd3 UTSW 4 116996396 missense probably benign 0.08
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1517:Hectd3 UTSW 4 117002994 missense probably damaging 0.96
R1584:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1593:Hectd3 UTSW 4 116997020 missense possibly damaging 0.86
R1628:Hectd3 UTSW 4 116997392 missense probably damaging 1.00
R1669:Hectd3 UTSW 4 116999643 missense probably damaging 0.98
R1731:Hectd3 UTSW 4 116996455 critical splice donor site probably null
R1918:Hectd3 UTSW 4 117000343 missense possibly damaging 0.68
R2029:Hectd3 UTSW 4 117000685 missense probably damaging 0.99
R2174:Hectd3 UTSW 4 116999701 missense probably benign 0.04
R2184:Hectd3 UTSW 4 117000903 missense possibly damaging 0.93
R2226:Hectd3 UTSW 4 116995689 missense possibly damaging 0.67
R3721:Hectd3 UTSW 4 116999745 missense probably benign 0.08
R3895:Hectd3 UTSW 4 116996089 missense probably damaging 1.00
R3937:Hectd3 UTSW 4 116998530 missense probably benign 0.28
R4291:Hectd3 UTSW 4 116995692 missense probably damaging 1.00
R4729:Hectd3 UTSW 4 116997218 missense probably damaging 0.98
R4837:Hectd3 UTSW 4 117002597 missense probably null 0.32
R5059:Hectd3 UTSW 4 116997164 missense possibly damaging 0.93
R5090:Hectd3 UTSW 4 117000238 splice site probably benign
R5910:Hectd3 UTSW 4 117002134 missense probably benign 0.09
R5932:Hectd3 UTSW 4 117002273 missense possibly damaging 0.79
R6182:Hectd3 UTSW 4 117000279 missense probably damaging 1.00
R6292:Hectd3 UTSW 4 116998808 missense probably damaging 1.00
R6405:Hectd3 UTSW 4 117000624 missense probably benign 0.04
R6478:Hectd3 UTSW 4 116999586 missense probably damaging 1.00
R7444:Hectd3 UTSW 4 116996927 missense possibly damaging 0.48
R7471:Hectd3 UTSW 4 116996588 missense probably benign 0.01
R8053:Hectd3 UTSW 4 117000858 missense possibly damaging 0.65
R8840:Hectd3 UTSW 4 116998407 missense probably benign 0.14
R9520:Hectd3 UTSW 4 117000685 missense probably damaging 0.99
R9746:Hectd3 UTSW 4 116995754 missense probably damaging 1.00
Z1177:Hectd3 UTSW 4 116998760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATTCACATCGCCTGGGATC -3'
(R):5'- TTCCAAGGGTAGTGGGACTAAG -3'

Sequencing Primer
(F):5'- TGGGATCCAGGCCTCAG -3'
(R):5'- GACTAAGTATGGTCTATGGGGAC -3'
Posted On 2021-03-08