Incidental Mutation 'R8671:Tinagl1'
ID 661151
Institutional Source Beutler Lab
Gene Symbol Tinagl1
Ensembl Gene ENSMUSG00000028776
Gene Name tubulointerstitial nephritis antigen-like 1
Synonyms 1110021J17Rik, Lcn7, Arg1, androgen-regulated gene 1, AZ-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 130164454-130175122 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130167804 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 250 (T250A)
Ref Sequence ENSEMBL: ENSMUSP00000101621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030560] [ENSMUST00000105998] [ENSMUST00000105999] [ENSMUST00000132545] [ENSMUST00000175992]
AlphaFold Q99JR5
Predicted Effect probably benign
Transcript: ENSMUST00000030560
AA Change: T250A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030560
Gene: ENSMUSG00000028776
AA Change: T250A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Pept_C1 202 455 2.62e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105998
AA Change: T250A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101620
Gene: ENSMUSG00000028776
AA Change: T250A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Pept_C1 202 455 2.62e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105999
AA Change: T250A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101621
Gene: ENSMUSG00000028776
AA Change: T250A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Pept_C1 202 455 2.62e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132545
SMART Domains Protein: ENSMUSP00000135453
Gene: ENSMUSG00000028776

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175992
AA Change: T219A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134900
Gene: ENSMUSG00000028776
AA Change: T219A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Pept_C1 171 424 2.62e-62 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to tubulointerstitial nephritis antigen, a secreted glycoprotein that is recognized by antibodies in some types of immune-related tubulointerstitial nephritis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Female mice homozygous for a null mutation display impaired fertility and homozygous pups born to homozygous females show impaired postnatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,942,929 E145K probably damaging Het
4930430A15Rik T C 2: 111,229,532 probably benign Het
4930467E23Rik T A 8: 19,734,759 L203* probably null Het
Ambp A T 4: 63,150,419 Y120* probably null Het
Ankrd36 C T 11: 5,629,312 A192V probably benign Het
Apol7e A T 15: 77,717,603 M134L probably benign Het
Atg9b A T 5: 24,386,109 N774K probably benign Het
BC027072 G T 17: 71,751,377 A435E probably benign Het
Catsperb T A 12: 101,594,337 N862K possibly damaging Het
Ccdc7a T A 8: 128,920,467 D648V probably damaging Het
Cfap54 G T 10: 92,955,072 P1855T unknown Het
Clcnkb T A 4: 141,412,230 T154S probably damaging Het
Cux1 C T 5: 136,250,600 R609H probably damaging Het
Eif2ak4 A G 2: 118,422,186 D413G possibly damaging Het
Flnc T C 6: 29,443,502 probably null Het
Grm5 T C 7: 88,116,290 probably null Het
Hectd3 T G 4: 116,996,581 F225V possibly damaging Het
Hpcal4 G T 4: 123,189,183 M107I probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ikbkap A G 4: 56,771,453 L948P probably damaging Het
Larp4 C A 15: 100,010,458 Q607K probably benign Het
March8 A G 6: 116,401,854 R250G probably benign Het
Med13 A C 11: 86,271,097 N2135K probably damaging Het
Msh5 T A 17: 35,045,933 R89* probably null Het
Musk T G 4: 58,286,051 probably benign Het
Myo18b T C 5: 112,874,743 Q261R unknown Het
Npr1 A T 3: 90,456,157 probably benign Het
Nynrin T A 14: 55,870,442 V1002E possibly damaging Het
Olfr1138 A T 2: 87,737,646 L226Q probably damaging Het
Olfr1195 A T 2: 88,683,105 F209Y probably benign Het
Olfr1315-ps1 T A 2: 112,110,988 K88M probably damaging Het
Olfr167 T C 16: 19,515,054 Y194C possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prkd1 T A 12: 50,388,408 N512I probably benign Het
Pwwp2b C T 7: 139,256,410 P589L probably damaging Het
Rasgrp4 G A 7: 29,143,027 G242D probably damaging Het
Rcbtb1 T G 14: 59,230,524 V480G probably damaging Het
Rptn A G 3: 93,398,194 S945G probably benign Het
Slc22a2 C T 17: 12,605,976 Q242* probably null Het
Slfn3 T A 11: 83,212,999 V232E probably benign Het
Stab1 T A 14: 31,157,408 K705M probably damaging Het
Syn2 C A 6: 115,278,167 S480* probably null Het
Thsd4 A T 9: 60,394,445 L189H probably damaging Het
Tnc A T 4: 64,017,446 C418S probably damaging Het
Ube2q1 A G 3: 89,776,078 E110G probably damaging Het
Wdfy4 G T 14: 32,971,765 probably benign Het
Xcl1 T C 1: 164,931,850 M94V probably benign Het
Zfp369 T C 13: 65,296,281 S413P possibly damaging Het
Zfp454 A C 11: 50,873,768 I279S possibly damaging Het
Zfp971 A C 2: 178,033,937 Q443P probably damaging Het
Other mutations in Tinagl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01908:Tinagl1 APN 4 130167430 missense probably damaging 1.00
IGL01935:Tinagl1 APN 4 130168001 missense probably damaging 1.00
R0125:Tinagl1 UTSW 4 130166308 missense probably damaging 1.00
R0893:Tinagl1 UTSW 4 130174023 missense probably damaging 1.00
R1731:Tinagl1 UTSW 4 130168049 missense probably benign
R2020:Tinagl1 UTSW 4 130166972 missense probably damaging 1.00
R2264:Tinagl1 UTSW 4 130167433 missense probably benign 0.00
R2281:Tinagl1 UTSW 4 130166993 missense probably damaging 1.00
R4786:Tinagl1 UTSW 4 130173931 missense probably benign 0.21
R5058:Tinagl1 UTSW 4 130167457 missense probably benign
R5908:Tinagl1 UTSW 4 130172970 nonsense probably null
R6247:Tinagl1 UTSW 4 130172932 missense probably null 1.00
R6608:Tinagl1 UTSW 4 130172989 missense probably benign 0.00
R7699:Tinagl1 UTSW 4 130168039 missense probably benign 0.36
R8109:Tinagl1 UTSW 4 130169330 missense probably damaging 0.99
R8351:Tinagl1 UTSW 4 130167583 missense probably damaging 0.99
R8446:Tinagl1 UTSW 4 130166901 critical splice donor site probably null
R8451:Tinagl1 UTSW 4 130167583 missense probably damaging 0.99
R9008:Tinagl1 UTSW 4 130174030 missense probably damaging 1.00
R9227:Tinagl1 UTSW 4 130167478 missense probably benign 0.42
Z1176:Tinagl1 UTSW 4 130166314 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCACAAAGCCTAGGTTCTAAAGG -3'
(R):5'- CTACCCACTGCCTTTGAAGC -3'

Sequencing Primer
(F):5'- CCTAGGTTCTAAAGGGTGCTATATCC -3'
(R):5'- CACTGCCTTTGAAGCTTCAGAGAAG -3'
Posted On 2021-03-08