Mutagenetix > Incidental Mutation

Incidental Mutation 'R8671:Cux1'

661155

Institutional Source

Beutler Lab

Gene Symbol

Cux1

Ensembl Gene

ENSMUSG00000029705

Gene Name

cut-like homeobox 1

Synonyms

Cux-1, Cutl1, CDP, Cux

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.894) question?

Stock #

R8671 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

136248135-136567490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 136250600 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 609 (R609H)

Ref Sequence

ENSEMBL: ENSMUSP00000135054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000175918] [ENSMUST00000175998] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000177297] [ENSMUST00000196245]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000175918

SMART Domains

Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	73	328	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000175998
AA Change: R403H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705
AA Change: R403H

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
coiled coil region	76	148	N/A	INTRINSIC
Pfam:CASP_C	204	430	8.6e-72	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176216
AA Change: R609H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705
AA Change: R609H

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	9.35e-5	PROSPERO
Pfam:CASP_C	421	647	1.2e-71	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176745
AA Change: R607H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705
AA Change: R607H

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
internal_repeat_1	367	388	8.95e-5	PROSPERO
Pfam:CASP_C	419	645	1.2e-71	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177297

SMART Domains

Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	8.99e-6	PROSPERO
Pfam:CASP_C	422	527	1.8e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196245

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (48/48)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	C	T	4: 73,942,929	E145K	probably damaging	Het
4930430A15Rik	T	C	2: 111,229,532		probably benign	Het
4930467E23Rik	T	A	8: 19,734,759	L203*	probably null	Het
Ambp	A	T	4: 63,150,419	Y120*	probably null	Het
Ankrd36	C	T	11: 5,629,312	A192V	probably benign	Het
Apol7e	A	T	15: 77,717,603	M134L	probably benign	Het
Atg9b	A	T	5: 24,386,109	N774K	probably benign	Het
BC027072	G	T	17: 71,751,377	A435E	probably benign	Het
Catsperb	T	A	12: 101,594,337	N862K	possibly damaging	Het
Ccdc7a	T	A	8: 128,920,467	D648V	probably damaging	Het
Cfap54	G	T	10: 92,955,072	P1855T	unknown	Het
Clcnkb	T	A	4: 141,412,230	T154S	probably damaging	Het
Eif2ak4	A	G	2: 118,422,186	D413G	possibly damaging	Het
Flnc	T	C	6: 29,443,502		probably null	Het
Grm5	T	C	7: 88,116,290		probably null	Het
Hectd3	T	G	4: 116,996,581	F225V	possibly damaging	Het
Hpcal4	G	T	4: 123,189,183	M107I	probably benign	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ikbkap	A	G	4: 56,771,453	L948P	probably damaging	Het
Larp4	C	A	15: 100,010,458	Q607K	probably benign	Het
March8	A	G	6: 116,401,854	R250G	probably benign	Het
Med13	A	C	11: 86,271,097	N2135K	probably damaging	Het
Msh5	T	A	17: 35,045,933	R89*	probably null	Het
Musk	T	G	4: 58,286,051		probably benign	Het
Myo18b	T	C	5: 112,874,743	Q261R	unknown	Het
Npr1	A	T	3: 90,456,157		probably benign	Het
Nynrin	T	A	14: 55,870,442	V1002E	possibly damaging	Het
Olfr1138	A	T	2: 87,737,646	L226Q	probably damaging	Het
Olfr1195	A	T	2: 88,683,105	F209Y	probably benign	Het
Olfr1315-ps1	T	A	2: 112,110,988	K88M	probably damaging	Het
Olfr167	T	C	16: 19,515,054	Y194C	possibly damaging	Het
Pcdh9	T	C	14: 93,888,650	Y28C	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Prkd1	T	A	12: 50,388,408	N512I	probably benign	Het
Pwwp2b	C	T	7: 139,256,410	P589L	probably damaging	Het
Rasgrp4	G	A	7: 29,143,027	G242D	probably damaging	Het
Rcbtb1	T	G	14: 59,230,524	V480G	probably damaging	Het
Rptn	A	G	3: 93,398,194	S945G	probably benign	Het
Slc22a2	C	T	17: 12,605,976	Q242*	probably null	Het
Slfn3	T	A	11: 83,212,999	V232E	probably benign	Het
Stab1	T	A	14: 31,157,408	K705M	probably damaging	Het
Syn2	C	A	6: 115,278,167	S480*	probably null	Het
Thsd4	A	T	9: 60,394,445	L189H	probably damaging	Het
Tinagl1	T	C	4: 130,167,804	T250A	probably benign	Het
Tnc	A	T	4: 64,017,446	C418S	probably damaging	Het
Ube2q1	A	G	3: 89,776,078	E110G	probably damaging	Het
Wdfy4	G	T	14: 32,971,765		probably benign	Het
Xcl1	T	C	1: 164,931,850	M94V	probably benign	Het
Zfp369	T	C	13: 65,296,281	S413P	possibly damaging	Het
Zfp454	A	C	11: 50,873,768	I279S	possibly damaging	Het
Zfp971	A	C	2: 178,033,937	Q443P	probably damaging	Het

Other mutations in Cux1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Cux1	APN	5	136326796	missense	probably damaging	1.00
IGL00966:Cux1	APN	5	136311491	intron	probably benign
IGL01129:Cux1	APN	5	136304718	intron	probably benign
IGL01885:Cux1	APN	5	136308447	missense	possibly damaging	0.90
IGL01947:Cux1	APN	5	136275125	missense	probably benign	0.04
IGL02259:Cux1	APN	5	136326833	missense	probably damaging	1.00
IGL02666:Cux1	APN	5	136275315	nonsense	probably null
IGL02826:Cux1	APN	5	136308003	missense	probably damaging	1.00
IGL03014:Cux1	UTSW	5	136565525	intron	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0057:Cux1	UTSW	5	136256282	missense	probably damaging	1.00
R0149:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0295:Cux1	UTSW	5	136313212	missense	probably benign	0.04
R0361:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0533:Cux1	UTSW	5	136307859	missense	probably damaging	1.00
R0630:Cux1	UTSW	5	136286835	missense	probably damaging	1.00
R0801:Cux1	UTSW	5	136326929	missense	probably damaging	0.97
R0884:Cux1	UTSW	5	136307835	missense	probably damaging	1.00
R0976:Cux1	UTSW	5	136313290	missense	probably damaging	1.00
R1073:Cux1	UTSW	5	136252541	critical splice donor site	probably null
R1222:Cux1	UTSW	5	136275149	missense	probably benign	0.18
R1518:Cux1	UTSW	5	136308279	missense	probably benign	0.29
R1686:Cux1	UTSW	5	136275381	nonsense	probably null
R1687:Cux1	UTSW	5	136312669	missense	probably damaging	1.00
R1758:Cux1	UTSW	5	136392322	missense	probably damaging	1.00
R1797:Cux1	UTSW	5	136275315	missense	probably benign	0.22
R1919:Cux1	UTSW	5	136363319	nonsense	probably null
R2051:Cux1	UTSW	5	136332658	missense	probably damaging	1.00
R2339:Cux1	UTSW	5	136287008	missense	probably damaging	1.00
R3438:Cux1	UTSW	5	136311560	missense	probably damaging	0.97
R3713:Cux1	UTSW	5	136565543	intron	probably benign
R3800:Cux1	UTSW	5	136316033	missense	probably damaging	1.00
R3964:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R4135:Cux1	UTSW	5	136307896	missense	probably damaging	1.00
R4198:Cux1	UTSW	5	136286848	missense	probably damaging	1.00
R4467:Cux1	UTSW	5	136312722	missense	probably damaging	1.00
R4498:Cux1	UTSW	5	136312993	missense	probably damaging	1.00
R4622:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4623:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4651:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4652:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4658:Cux1	UTSW	5	136250594	missense	possibly damaging	0.80
R4665:Cux1	UTSW	5	136286799	missense	probably damaging	1.00
R4704:Cux1	UTSW	5	136249201	missense	probably benign	0.01
R4867:Cux1	UTSW	5	136274961	intron	probably benign
R4965:Cux1	UTSW	5	136311556	missense	possibly damaging	0.77
R5090:Cux1	UTSW	5	136313200	missense	possibly damaging	0.95
R5155:Cux1	UTSW	5	136565441	intron	probably benign
R5226:Cux1	UTSW	5	136370173	missense	probably benign	0.01
R5252:Cux1	UTSW	5	136308297	missense	probably damaging	0.98
R5266:Cux1	UTSW	5	136312694	missense	probably damaging	1.00
R5399:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R5509:Cux1	UTSW	5	136275317	missense	probably benign	0.13
R5609:Cux1	UTSW	5	136392320	missense	probably damaging	1.00
R5681:Cux1	UTSW	5	136308184	missense	probably damaging	1.00
R5993:Cux1	UTSW	5	136363271	missense	probably benign	0.00
R6049:Cux1	UTSW	5	136332710	missense	probably damaging	1.00
R6290:Cux1	UTSW	5	136311558	missense	probably damaging	0.99
R6310:Cux1	UTSW	5	136275164	missense	probably benign	0.10
R6351:Cux1	UTSW	5	136309792	missense	probably damaging	1.00
R6531:Cux1	UTSW	5	136275119	missense	probably benign	0.03
R6590:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6663:Cux1	UTSW	5	136485847	missense	probably damaging	1.00
R6690:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6777:Cux1	UTSW	5	136565568	intron	probably benign
R6786:Cux1	UTSW	5	136567231	missense	probably damaging	1.00
R6817:Cux1	UTSW	5	136373173	splice site	probably null
R6989:Cux1	UTSW	5	136279648	nonsense	probably null
R7011:Cux1	UTSW	5	136360033	missense	probably damaging	1.00
R7167:Cux1	UTSW	5	136310041	splice site	probably null
R7699:Cux1	UTSW	5	136485739	critical splice donor site	probably null
R7861:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R7876:Cux1	UTSW	5	136363307	missense	probably benign	0.00
R7916:Cux1	UTSW	5	136282961	missense	probably damaging	1.00
R8023:Cux1	UTSW	5	136373397	missense	probably damaging	0.99
R8154:Cux1	UTSW	5	136252580	missense	probably damaging	1.00
R8267:Cux1	UTSW	5	136282999	missense	probably damaging	1.00
R8289:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8305:Cux1	UTSW	5	136360009	missense	probably benign	0.02
R8319:Cux1	UTSW	5	136565397	missense	probably benign	0.02
R8405:Cux1	UTSW	5	136275387	missense	possibly damaging	0.83
R8483:Cux1	UTSW	5	136275090	missense	possibly damaging	0.83
R8506:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8680:Cux1	UTSW	5	136307856	missense	possibly damaging	0.46
R8737:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R8738:Cux1	UTSW	5	136373366	missense	probably damaging	1.00
R8793:Cux1	UTSW	5	136565685	missense	unknown
R8897:Cux1	UTSW	5	136286769	missense	probably damaging	1.00
R8926:Cux1	UTSW	5	136309550	intron	probably benign
R8954:Cux1	UTSW	5	136373349	nonsense	probably null
R9092:Cux1	UTSW	5	136485817	missense	probably damaging	1.00
R9205:Cux1	UTSW	5	136370135	missense	probably damaging	1.00
R9550:Cux1	UTSW	5	136311533	missense	probably damaging	0.99
R9578:Cux1	UTSW	5	136254065	critical splice donor site	probably null
R9682:Cux1	UTSW	5	136308262	missense	probably benign
R9701:Cux1	UTSW	5	136314315	missense	probably damaging	0.97
R9712:Cux1	UTSW	5	136309819	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- GCATTGAAGTCCTCAGCCTTGG -3'
(R):5'- TGTGTACATGCATGCACCC -3'

Sequencing Primer
(F):5'- AGCCAGCGCTGAGGACATG -3'
(R):5'- CAAAGAACTCACCTTTGCCGTCTG -3'

Posted On

2021-03-08