Incidental Mutation 'R8671:Cux1'
ID 661155
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Name cut-like homeobox 1
Synonyms Cux-1, Cutl1, CDP, Cux
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 136248135-136567490 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 136250600 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 609 (R609H)
Ref Sequence ENSEMBL: ENSMUSP00000135054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175918] [ENSMUST00000175998] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000177297] [ENSMUST00000196245]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000175918
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175998
AA Change: R403H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705
AA Change: R403H

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
Pfam:CASP_C 204 430 8.6e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176216
AA Change: R609H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705
AA Change: R609H

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176745
AA Change: R607H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705
AA Change: R607H

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177297
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196245
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,942,929 E145K probably damaging Het
4930430A15Rik T C 2: 111,229,532 probably benign Het
4930467E23Rik T A 8: 19,734,759 L203* probably null Het
Ambp A T 4: 63,150,419 Y120* probably null Het
Ankrd36 C T 11: 5,629,312 A192V probably benign Het
Apol7e A T 15: 77,717,603 M134L probably benign Het
Atg9b A T 5: 24,386,109 N774K probably benign Het
BC027072 G T 17: 71,751,377 A435E probably benign Het
Catsperb T A 12: 101,594,337 N862K possibly damaging Het
Ccdc7a T A 8: 128,920,467 D648V probably damaging Het
Cfap54 G T 10: 92,955,072 P1855T unknown Het
Clcnkb T A 4: 141,412,230 T154S probably damaging Het
Eif2ak4 A G 2: 118,422,186 D413G possibly damaging Het
Flnc T C 6: 29,443,502 probably null Het
Grm5 T C 7: 88,116,290 probably null Het
Hectd3 T G 4: 116,996,581 F225V possibly damaging Het
Hpcal4 G T 4: 123,189,183 M107I probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ikbkap A G 4: 56,771,453 L948P probably damaging Het
Larp4 C A 15: 100,010,458 Q607K probably benign Het
March8 A G 6: 116,401,854 R250G probably benign Het
Med13 A C 11: 86,271,097 N2135K probably damaging Het
Msh5 T A 17: 35,045,933 R89* probably null Het
Musk T G 4: 58,286,051 probably benign Het
Myo18b T C 5: 112,874,743 Q261R unknown Het
Npr1 A T 3: 90,456,157 probably benign Het
Nynrin T A 14: 55,870,442 V1002E possibly damaging Het
Olfr1138 A T 2: 87,737,646 L226Q probably damaging Het
Olfr1195 A T 2: 88,683,105 F209Y probably benign Het
Olfr1315-ps1 T A 2: 112,110,988 K88M probably damaging Het
Olfr167 T C 16: 19,515,054 Y194C possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prkd1 T A 12: 50,388,408 N512I probably benign Het
Pwwp2b C T 7: 139,256,410 P589L probably damaging Het
Rasgrp4 G A 7: 29,143,027 G242D probably damaging Het
Rcbtb1 T G 14: 59,230,524 V480G probably damaging Het
Rptn A G 3: 93,398,194 S945G probably benign Het
Slc22a2 C T 17: 12,605,976 Q242* probably null Het
Slfn3 T A 11: 83,212,999 V232E probably benign Het
Stab1 T A 14: 31,157,408 K705M probably damaging Het
Syn2 C A 6: 115,278,167 S480* probably null Het
Thsd4 A T 9: 60,394,445 L189H probably damaging Het
Tinagl1 T C 4: 130,167,804 T250A probably benign Het
Tnc A T 4: 64,017,446 C418S probably damaging Het
Ube2q1 A G 3: 89,776,078 E110G probably damaging Het
Wdfy4 G T 14: 32,971,765 probably benign Het
Xcl1 T C 1: 164,931,850 M94V probably benign Het
Zfp369 T C 13: 65,296,281 S413P possibly damaging Het
Zfp454 A C 11: 50,873,768 I279S possibly damaging Het
Zfp971 A C 2: 178,033,937 Q443P probably damaging Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136326796 missense probably damaging 1.00
IGL00966:Cux1 APN 5 136311491 intron probably benign
IGL01129:Cux1 APN 5 136304718 intron probably benign
IGL01885:Cux1 APN 5 136308447 missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136275125 missense probably benign 0.04
IGL02259:Cux1 APN 5 136326833 missense probably damaging 1.00
IGL02666:Cux1 APN 5 136275315 nonsense probably null
IGL02826:Cux1 APN 5 136308003 missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136565525 intron probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0057:Cux1 UTSW 5 136256282 missense probably damaging 1.00
R0149:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0295:Cux1 UTSW 5 136313212 missense probably benign 0.04
R0361:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0533:Cux1 UTSW 5 136307859 missense probably damaging 1.00
R0630:Cux1 UTSW 5 136286835 missense probably damaging 1.00
R0801:Cux1 UTSW 5 136326929 missense probably damaging 0.97
R0884:Cux1 UTSW 5 136307835 missense probably damaging 1.00
R0976:Cux1 UTSW 5 136313290 missense probably damaging 1.00
R1073:Cux1 UTSW 5 136252541 critical splice donor site probably null
R1222:Cux1 UTSW 5 136275149 missense probably benign 0.18
R1518:Cux1 UTSW 5 136308279 missense probably benign 0.29
R1686:Cux1 UTSW 5 136275381 nonsense probably null
R1687:Cux1 UTSW 5 136312669 missense probably damaging 1.00
R1758:Cux1 UTSW 5 136392322 missense probably damaging 1.00
R1797:Cux1 UTSW 5 136275315 missense probably benign 0.22
R1919:Cux1 UTSW 5 136363319 nonsense probably null
R2051:Cux1 UTSW 5 136332658 missense probably damaging 1.00
R2339:Cux1 UTSW 5 136287008 missense probably damaging 1.00
R3438:Cux1 UTSW 5 136311560 missense probably damaging 0.97
R3713:Cux1 UTSW 5 136565543 intron probably benign
R3800:Cux1 UTSW 5 136316033 missense probably damaging 1.00
R3964:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R4135:Cux1 UTSW 5 136307896 missense probably damaging 1.00
R4198:Cux1 UTSW 5 136286848 missense probably damaging 1.00
R4467:Cux1 UTSW 5 136312722 missense probably damaging 1.00
R4498:Cux1 UTSW 5 136312993 missense probably damaging 1.00
R4622:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4623:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4651:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4652:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4658:Cux1 UTSW 5 136250594 missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136286799 missense probably damaging 1.00
R4704:Cux1 UTSW 5 136249201 missense probably benign 0.01
R4867:Cux1 UTSW 5 136274961 intron probably benign
R4965:Cux1 UTSW 5 136311556 missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136313200 missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136565441 intron probably benign
R5226:Cux1 UTSW 5 136370173 missense probably benign 0.01
R5252:Cux1 UTSW 5 136308297 missense probably damaging 0.98
R5266:Cux1 UTSW 5 136312694 missense probably damaging 1.00
R5399:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136275317 missense probably benign 0.13
R5609:Cux1 UTSW 5 136392320 missense probably damaging 1.00
R5681:Cux1 UTSW 5 136308184 missense probably damaging 1.00
R5993:Cux1 UTSW 5 136363271 missense probably benign 0.00
R6049:Cux1 UTSW 5 136332710 missense probably damaging 1.00
R6290:Cux1 UTSW 5 136311558 missense probably damaging 0.99
R6310:Cux1 UTSW 5 136275164 missense probably benign 0.10
R6351:Cux1 UTSW 5 136309792 missense probably damaging 1.00
R6531:Cux1 UTSW 5 136275119 missense probably benign 0.03
R6590:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6663:Cux1 UTSW 5 136485847 missense probably damaging 1.00
R6690:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6777:Cux1 UTSW 5 136565568 intron probably benign
R6786:Cux1 UTSW 5 136567231 missense probably damaging 1.00
R6817:Cux1 UTSW 5 136373173 splice site probably null
R6989:Cux1 UTSW 5 136279648 nonsense probably null
R7011:Cux1 UTSW 5 136360033 missense probably damaging 1.00
R7167:Cux1 UTSW 5 136310041 splice site probably null
R7699:Cux1 UTSW 5 136485739 critical splice donor site probably null
R7861:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R7876:Cux1 UTSW 5 136363307 missense probably benign 0.00
R7916:Cux1 UTSW 5 136282961 missense probably damaging 1.00
R8023:Cux1 UTSW 5 136373397 missense probably damaging 0.99
R8154:Cux1 UTSW 5 136252580 missense probably damaging 1.00
R8267:Cux1 UTSW 5 136282999 missense probably damaging 1.00
R8289:Cux1 UTSW 5 136308504 missense probably damaging 0.99
R8305:Cux1 UTSW 5 136360009 missense probably benign 0.02
R8319:Cux1 UTSW 5 136565397 missense probably benign 0.02
R8405:Cux1 UTSW 5 136275387 missense possibly damaging 0.83
R8483:Cux1 UTSW 5 136275090 missense possibly damaging 0.83
R8506:Cux1 UTSW 5 136308504 missense probably damaging 0.99
R8680:Cux1 UTSW 5 136307856 missense possibly damaging 0.46
R8737:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R8738:Cux1 UTSW 5 136373366 missense probably damaging 1.00
R8793:Cux1 UTSW 5 136565685 missense unknown
R8897:Cux1 UTSW 5 136286769 missense probably damaging 1.00
R8926:Cux1 UTSW 5 136309550 intron probably benign
R8954:Cux1 UTSW 5 136373349 nonsense probably null
R9092:Cux1 UTSW 5 136485817 missense probably damaging 1.00
R9205:Cux1 UTSW 5 136370135 missense probably damaging 1.00
R9550:Cux1 UTSW 5 136311533 missense probably damaging 0.99
R9578:Cux1 UTSW 5 136254065 critical splice donor site probably null
R9682:Cux1 UTSW 5 136308262 missense probably benign
R9701:Cux1 UTSW 5 136314315 missense probably damaging 0.97
R9712:Cux1 UTSW 5 136309819 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GCATTGAAGTCCTCAGCCTTGG -3'
(R):5'- TGTGTACATGCATGCACCC -3'

Sequencing Primer
(F):5'- AGCCAGCGCTGAGGACATG -3'
(R):5'- CAAAGAACTCACCTTTGCCGTCTG -3'
Posted On 2021-03-08