Incidental Mutation 'R8671:Syn2'
ID 661157
Institutional Source Beutler Lab
Gene Symbol Syn2
Ensembl Gene ENSMUSG00000009394
Gene Name synapsin II
Synonyms Synapsin IIb, 2900074L19Rik, Synapsin IIa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 115134902-115282006 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 115278167 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 480 (S480*)
Ref Sequence ENSEMBL: ENSMUSP00000009538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009538] [ENSMUST00000169345] [ENSMUST00000203450]
AlphaFold Q64332
Predicted Effect probably null
Transcript: ENSMUST00000009538
AA Change: S480*
SMART Domains Protein: ENSMUSP00000009538
Gene: ENSMUSG00000009394
AA Change: S480*

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 3.4e-24 PFAM
Pfam:Synapsin 112 213 6.4e-48 PFAM
Pfam:Synapsin_C 215 417 8.2e-140 PFAM
low complexity region 450 470 N/A INTRINSIC
low complexity region 473 507 N/A INTRINSIC
low complexity region 524 540 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169345
SMART Domains Protein: ENSMUSP00000133121
Gene: ENSMUSG00000009394

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 1.3e-24 PFAM
Pfam:Synapsin 109 213 1.6e-62 PFAM
Pfam:Synapsin_C 215 417 4.4e-133 PFAM
Pfam:RimK 247 403 4.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203450
SMART Domains Protein: ENSMUSP00000144921
Gene: ENSMUSG00000009394

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 2.7e-24 PFAM
Pfam:Synapsin 112 213 4.6e-48 PFAM
Pfam:Synapsin_C 215 417 5.3e-140 PFAM
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. This member of the synapsin family encodes a neuron-specific phosphoprotein that selectively binds to small synaptic vesicles in the presynaptic nerve terminal. Polymorphisms in this gene are associated with abnormal presynaptic function and related neuronal disorders, including autism, epilepsy, bipolar disorder and schizophrenia. Alternative splicing of this gene results in multiple transcript variants. The tissue inhibitor of metalloproteinase 4 gene is located within an intron of this gene and is transcribed in the opposite direction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in central nervous system abnormalities. One model showed delayed synapse formation and decreased brain weight while another allele showed decreased post-tetanic potentiation and increased synaptic depression and development of convulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,942,929 E145K probably damaging Het
4930430A15Rik T C 2: 111,229,532 probably benign Het
4930467E23Rik T A 8: 19,734,759 L203* probably null Het
Ambp A T 4: 63,150,419 Y120* probably null Het
Ankrd36 C T 11: 5,629,312 A192V probably benign Het
Apol7e A T 15: 77,717,603 M134L probably benign Het
Atg9b A T 5: 24,386,109 N774K probably benign Het
BC027072 G T 17: 71,751,377 A435E probably benign Het
Catsperb T A 12: 101,594,337 N862K possibly damaging Het
Ccdc7a T A 8: 128,920,467 D648V probably damaging Het
Cfap54 G T 10: 92,955,072 P1855T unknown Het
Clcnkb T A 4: 141,412,230 T154S probably damaging Het
Cux1 C T 5: 136,250,600 R609H probably damaging Het
Eif2ak4 A G 2: 118,422,186 D413G possibly damaging Het
Flnc T C 6: 29,443,502 probably null Het
Grm5 T C 7: 88,116,290 probably null Het
Hectd3 T G 4: 116,996,581 F225V possibly damaging Het
Hpcal4 G T 4: 123,189,183 M107I probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ikbkap A G 4: 56,771,453 L948P probably damaging Het
Larp4 C A 15: 100,010,458 Q607K probably benign Het
March8 A G 6: 116,401,854 R250G probably benign Het
Med13 A C 11: 86,271,097 N2135K probably damaging Het
Msh5 T A 17: 35,045,933 R89* probably null Het
Musk T G 4: 58,286,051 probably benign Het
Myo18b T C 5: 112,874,743 Q261R unknown Het
Npr1 A T 3: 90,456,157 probably benign Het
Nynrin T A 14: 55,870,442 V1002E possibly damaging Het
Olfr1138 A T 2: 87,737,646 L226Q probably damaging Het
Olfr1195 A T 2: 88,683,105 F209Y probably benign Het
Olfr1315-ps1 T A 2: 112,110,988 K88M probably damaging Het
Olfr167 T C 16: 19,515,054 Y194C possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prkd1 T A 12: 50,388,408 N512I probably benign Het
Pwwp2b C T 7: 139,256,410 P589L probably damaging Het
Rasgrp4 G A 7: 29,143,027 G242D probably damaging Het
Rcbtb1 T G 14: 59,230,524 V480G probably damaging Het
Rptn A G 3: 93,398,194 S945G probably benign Het
Slc22a2 C T 17: 12,605,976 Q242* probably null Het
Slfn3 T A 11: 83,212,999 V232E probably benign Het
Stab1 T A 14: 31,157,408 K705M probably damaging Het
Thsd4 A T 9: 60,394,445 L189H probably damaging Het
Tinagl1 T C 4: 130,167,804 T250A probably benign Het
Tnc A T 4: 64,017,446 C418S probably damaging Het
Ube2q1 A G 3: 89,776,078 E110G probably damaging Het
Wdfy4 G T 14: 32,971,765 probably benign Het
Xcl1 T C 1: 164,931,850 M94V probably benign Het
Zfp369 T C 13: 65,296,281 S413P possibly damaging Het
Zfp454 A C 11: 50,873,768 I279S possibly damaging Het
Zfp971 A C 2: 178,033,937 Q443P probably damaging Het
Other mutations in Syn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03040:Syn2 APN 6 115263965 missense possibly damaging 0.92
IGL03328:Syn2 APN 6 115274260 missense probably damaging 0.97
R0044:Syn2 UTSW 6 115135147 missense unknown
R0267:Syn2 UTSW 6 115254150 unclassified probably benign
R2026:Syn2 UTSW 6 115278251 missense probably benign 0.01
R2290:Syn2 UTSW 6 115274229 missense possibly damaging 0.91
R2900:Syn2 UTSW 6 115237334 missense possibly damaging 0.74
R3949:Syn2 UTSW 6 115227329 splice site probably null
R3983:Syn2 UTSW 6 115237298 missense probably benign 0.01
R5101:Syn2 UTSW 6 115263899 missense probably damaging 1.00
R5502:Syn2 UTSW 6 115278352 missense possibly damaging 0.96
R6334:Syn2 UTSW 6 115263914 missense possibly damaging 0.92
R6546:Syn2 UTSW 6 115281098 missense probably benign 0.18
R6766:Syn2 UTSW 6 115239401 missense probably damaging 0.97
R7491:Syn2 UTSW 6 115254654 missense probably benign 0.09
R9411:Syn2 UTSW 6 115254191 missense possibly damaging 0.67
R9764:Syn2 UTSW 6 115274258 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCCTTGGGTAGCTACGTAC -3'
(R):5'- GAAGGAGCTGCTGGGTTATC -3'

Sequencing Primer
(F):5'- GCCTTGGGTAGCTACGTACAATATC -3'
(R):5'- AGCTGCTGGGTTATCTTACTTGAGC -3'
Posted On 2021-03-08