Incidental Mutation 'R8671:Rasgrp4'
ID 661159
Institutional Source Beutler Lab
Gene Symbol Rasgrp4
Ensembl Gene ENSMUSG00000030589
Gene Name RAS guanyl releasing protein 4
Synonyms
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 28834358-28853386 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 28842452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 242 (G242D)
Ref Sequence ENSEMBL: ENSMUSP00000125137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032811] [ENSMUST00000094617] [ENSMUST00000159351] [ENSMUST00000159975] [ENSMUST00000160194] [ENSMUST00000161522] [ENSMUST00000203070] [ENSMUST00000203380] [ENSMUST00000204194] [ENSMUST00000204845] [ENSMUST00000205027]
AlphaFold Q8BTM9
Predicted Effect probably damaging
Transcript: ENSMUST00000032811
AA Change: G242D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032811
Gene: ENSMUSG00000030589
AA Change: G242D

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 590 4.12e-12 SMART
low complexity region 600 609 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094617
AA Change: G243D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092200
Gene: ENSMUSG00000030589
AA Change: G243D

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 163 2e-29 BLAST
low complexity region 164 189 N/A INTRINSIC
RasGEF 198 434 2.92e-70 SMART
C1 542 596 1.81e-8 SMART
low complexity region 606 615 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159351
AA Change: G242D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124183
Gene: ENSMUSG00000030589
AA Change: G242D

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 7e-31 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
Blast:RasGEF 449 553 7e-25 BLAST
SCOP:d1ptq__ 541 573 1e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159975
AA Change: G242D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125137
Gene: ENSMUSG00000030589
AA Change: G242D

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 595 1.81e-8 SMART
low complexity region 605 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160194
AA Change: G232D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124908
Gene: ENSMUSG00000030589
AA Change: G232D

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 8e-32 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 423 6.73e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161522
AA Change: G228D

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123718
Gene: ENSMUSG00000030589
AA Change: G228D

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 165 7e-32 BLAST
RasGEF 183 419 2.92e-70 SMART
C1 527 576 4.12e-12 SMART
low complexity region 586 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203070
AA Change: G242D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145352
Gene: ENSMUSG00000030589
AA Change: G242D

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 504 1.8e-20 SMART
C1 449 498 2.1e-14 SMART
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203380
AA Change: G242D

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144753
Gene: ENSMUSG00000030589
AA Change: G242D

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 364 3e-25 SMART
C1 472 521 2.1e-14 SMART
low complexity region 531 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204194
SMART Domains Protein: ENSMUSP00000145259
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 85 336 1e-7 SMART
C1 444 493 2.1e-14 SMART
low complexity region 503 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204845
SMART Domains Protein: ENSMUSP00000144774
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 399 8.7e-49 SMART
C1 507 556 2.1e-14 SMART
low complexity region 566 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205027
SMART Domains Protein: ENSMUSP00000145186
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
C1 352 401 2.1e-14 SMART
low complexity region 411 420 N/A INTRINSIC
Meta Mutation Damage Score 0.1015 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ras guanyl nucleotide-releasing protein (RasGRP) family of Ras guanine nucleotide exchange factors. It contains a Ras exchange motif, a diacylglycerol-binding domain, and two calcium-binding EF hands. This protein was shown to activate H-Ras in a cation-dependent manner in vitro. Expression of this protein in myeloid cell lines was found to be correlated with elevated level of activated RAS protein, and the RAS activation can be greatly enhanced by phorbol ester treatment, which suggested a role of this protein in diacylglycerol regulated cell signaling pathways. Studies of a mast cell leukemia cell line expressing substantial amounts of abnormal transcripts of this gene indicated that this gene may play an important role in the final stages of mast cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil reactive oxygen species production and chemotaxis in vitro. Mice homozygous for another knock-out allele exhibit decreased susceptibility to induced colitis and arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Rasgrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Rasgrp4 APN 7 28,847,966 (GRCm39) splice site probably benign
IGL01145:Rasgrp4 APN 7 28,850,898 (GRCm39) missense possibly damaging 0.83
IGL01806:Rasgrp4 APN 7 28,838,475 (GRCm39) missense possibly damaging 0.83
IGL02023:Rasgrp4 APN 7 28,838,335 (GRCm39) missense probably damaging 1.00
IGL02499:Rasgrp4 APN 7 28,850,928 (GRCm39) utr 3 prime probably benign
IGL02989:Rasgrp4 APN 7 28,847,831 (GRCm39) missense probably damaging 1.00
IGL03281:Rasgrp4 APN 7 28,845,450 (GRCm39) missense possibly damaging 0.69
R0092:Rasgrp4 UTSW 7 28,844,557 (GRCm39) missense possibly damaging 0.74
R0390:Rasgrp4 UTSW 7 28,845,285 (GRCm39) missense probably damaging 1.00
R0614:Rasgrp4 UTSW 7 28,845,276 (GRCm39) missense probably damaging 1.00
R0628:Rasgrp4 UTSW 7 28,839,635 (GRCm39) intron probably benign
R1420:Rasgrp4 UTSW 7 28,839,770 (GRCm39) missense probably damaging 0.98
R1434:Rasgrp4 UTSW 7 28,837,152 (GRCm39) critical splice donor site probably null
R1664:Rasgrp4 UTSW 7 28,839,688 (GRCm39) missense probably benign 0.00
R1911:Rasgrp4 UTSW 7 28,838,302 (GRCm39) missense probably damaging 1.00
R2164:Rasgrp4 UTSW 7 28,838,470 (GRCm39) missense probably damaging 1.00
R4277:Rasgrp4 UTSW 7 28,852,019 (GRCm39) unclassified probably benign
R5024:Rasgrp4 UTSW 7 28,847,832 (GRCm39) missense probably damaging 1.00
R5423:Rasgrp4 UTSW 7 28,844,561 (GRCm39) missense probably damaging 1.00
R5813:Rasgrp4 UTSW 7 28,844,639 (GRCm39) missense probably damaging 1.00
R5823:Rasgrp4 UTSW 7 28,837,142 (GRCm39) missense probably benign 0.00
R6268:Rasgrp4 UTSW 7 28,842,493 (GRCm39) missense probably damaging 1.00
R6285:Rasgrp4 UTSW 7 28,847,808 (GRCm39) missense probably damaging 1.00
R7062:Rasgrp4 UTSW 7 28,849,619 (GRCm39) missense possibly damaging 0.92
R7269:Rasgrp4 UTSW 7 28,847,855 (GRCm39) missense probably damaging 1.00
R7471:Rasgrp4 UTSW 7 28,845,405 (GRCm39) missense probably damaging 1.00
R7535:Rasgrp4 UTSW 7 28,838,484 (GRCm39) missense probably benign
R7792:Rasgrp4 UTSW 7 28,842,527 (GRCm39) missense probably damaging 1.00
R7854:Rasgrp4 UTSW 7 28,850,035 (GRCm39) missense unknown
R7855:Rasgrp4 UTSW 7 28,850,035 (GRCm39) missense unknown
R8052:Rasgrp4 UTSW 7 28,849,362 (GRCm39) missense probably damaging 1.00
R8144:Rasgrp4 UTSW 7 28,848,542 (GRCm39) missense probably damaging 1.00
R8253:Rasgrp4 UTSW 7 28,838,287 (GRCm39) missense possibly damaging 0.63
R8256:Rasgrp4 UTSW 7 28,842,500 (GRCm39) missense probably damaging 1.00
R8675:Rasgrp4 UTSW 7 28,842,452 (GRCm39) missense probably damaging 0.99
R8872:Rasgrp4 UTSW 7 28,838,521 (GRCm39) missense possibly damaging 0.86
R9647:Rasgrp4 UTSW 7 28,839,917 (GRCm39) missense probably damaging 0.99
R9681:Rasgrp4 UTSW 7 28,849,687 (GRCm39) missense probably benign
Z1088:Rasgrp4 UTSW 7 28,849,961 (GRCm39) intron probably benign
Z1186:Rasgrp4 UTSW 7 28,837,012 (GRCm39) missense probably benign
Z1186:Rasgrp4 UTSW 7 28,850,021 (GRCm39) intron probably benign
Z1186:Rasgrp4 UTSW 7 28,850,017 (GRCm39) intron probably benign
Z1186:Rasgrp4 UTSW 7 28,848,060 (GRCm39) missense probably damaging 1.00
Z1186:Rasgrp4 UTSW 7 28,847,985 (GRCm39) missense probably benign 0.01
Z1186:Rasgrp4 UTSW 7 28,845,302 (GRCm39) missense probably benign 0.01
Z1186:Rasgrp4 UTSW 7 28,838,241 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAATGATGTCAGGGACCTCC -3'
(R):5'- CTACAGTCCCAGAAGTGAGGAG -3'

Sequencing Primer
(F):5'- ATGTCAGGGACCTCCAGCAG -3'
(R):5'- GGGCACGCCTTTAATAATCTCAGG -3'
Posted On 2021-03-08