Incidental Mutation 'R8671:Pwwp2b'
ID 661163
Institutional Source Beutler Lab
Gene Symbol Pwwp2b
Ensembl Gene ENSMUSG00000060260
Gene Name PWWP domain containing 2B
Synonyms D7Ertd517e, D930023J19Rik, Pwwp2
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 138828398-138847172 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 138836326 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 589 (P589L)
Ref Sequence ENSEMBL: ENSMUSP00000130888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093993] [ENSMUST00000172136]
AlphaFold E9Q9M8
Predicted Effect probably benign
Transcript: ENSMUST00000093993
SMART Domains Protein: ENSMUSP00000091529
Gene: ENSMUSG00000060260

DomainStartEndE-ValueType
low complexity region 105 120 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
PDB:4LD6|A 485 506 4e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000172136
AA Change: P589L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130888
Gene: ENSMUSG00000060260
AA Change: P589L

DomainStartEndE-ValueType
low complexity region 105 120 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
Pfam:PWWP 498 583 5.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Pwwp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Pwwp2b APN 7 138,834,771 (GRCm39) nonsense probably null
IGL02209:Pwwp2b APN 7 138,835,021 (GRCm39) missense probably damaging 1.00
IGL02938:Pwwp2b APN 7 138,836,059 (GRCm39) missense probably damaging 1.00
Conservative UTSW 7 138,835,502 (GRCm39) missense probably benign 0.09
Edgy UTSW 7 138,835,978 (GRCm39) missense possibly damaging 0.90
R0033:Pwwp2b UTSW 7 138,834,844 (GRCm39) missense possibly damaging 0.87
R0033:Pwwp2b UTSW 7 138,834,844 (GRCm39) missense possibly damaging 0.87
R1491:Pwwp2b UTSW 7 138,835,879 (GRCm39) missense probably damaging 1.00
R1636:Pwwp2b UTSW 7 138,834,758 (GRCm39) missense probably benign 0.00
R1672:Pwwp2b UTSW 7 138,834,747 (GRCm39) missense probably benign
R1793:Pwwp2b UTSW 7 138,836,281 (GRCm39) missense probably damaging 0.97
R2016:Pwwp2b UTSW 7 138,836,067 (GRCm39) missense possibly damaging 0.91
R2159:Pwwp2b UTSW 7 138,834,844 (GRCm39) missense possibly damaging 0.87
R2228:Pwwp2b UTSW 7 138,835,104 (GRCm39) missense probably damaging 1.00
R2229:Pwwp2b UTSW 7 138,835,104 (GRCm39) missense probably damaging 1.00
R2380:Pwwp2b UTSW 7 138,835,366 (GRCm39) missense probably damaging 1.00
R3023:Pwwp2b UTSW 7 138,836,110 (GRCm39) missense probably damaging 1.00
R3933:Pwwp2b UTSW 7 138,835,950 (GRCm39) missense possibly damaging 0.66
R4440:Pwwp2b UTSW 7 138,835,555 (GRCm39) missense probably benign 0.09
R4844:Pwwp2b UTSW 7 138,835,502 (GRCm39) missense probably benign 0.09
R4873:Pwwp2b UTSW 7 138,835,978 (GRCm39) missense possibly damaging 0.90
R4875:Pwwp2b UTSW 7 138,835,978 (GRCm39) missense possibly damaging 0.90
R5022:Pwwp2b UTSW 7 138,835,494 (GRCm39) missense possibly damaging 0.81
R5446:Pwwp2b UTSW 7 138,835,066 (GRCm39) missense probably damaging 0.96
R5656:Pwwp2b UTSW 7 138,835,887 (GRCm39) missense possibly damaging 0.93
R6465:Pwwp2b UTSW 7 138,835,951 (GRCm39) missense probably benign 0.01
R6578:Pwwp2b UTSW 7 138,836,028 (GRCm39) missense probably damaging 1.00
R6774:Pwwp2b UTSW 7 138,835,903 (GRCm39) missense probably benign 0.13
R7218:Pwwp2b UTSW 7 138,836,049 (GRCm39) missense probably damaging 1.00
R7316:Pwwp2b UTSW 7 138,836,140 (GRCm39) missense probably benign 0.29
R7818:Pwwp2b UTSW 7 138,835,240 (GRCm39) missense probably benign
R8249:Pwwp2b UTSW 7 138,834,759 (GRCm39) missense probably damaging 0.99
R8319:Pwwp2b UTSW 7 138,835,099 (GRCm39) missense probably damaging 0.99
R8785:Pwwp2b UTSW 7 138,836,086 (GRCm39) missense possibly damaging 0.85
R9331:Pwwp2b UTSW 7 138,835,357 (GRCm39) missense probably damaging 1.00
X0017:Pwwp2b UTSW 7 138,835,722 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTCCTTGACATCAGCCTTG -3'
(R):5'- GCAAGTGTTTAGGACAGCCC -3'

Sequencing Primer
(F):5'- TGACATCAGCCTTGGCCAGAAG -3'
(R):5'- GTTTAGGACAGCCCCCTTTGAG -3'
Posted On 2021-03-08