Incidental Mutation 'R8671:Ccdc7a'
ID 661165
Institutional Source Beutler Lab
Gene Symbol Ccdc7a
Ensembl Gene ENSMUSG00000025808
Gene Name coiled-coil domain containing 7A
Synonyms 4930540C21Rik, 4930517G15Rik, Ccdc7
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.048) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 129460715-129791973 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 129646948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 648 (D648V)
Ref Sequence ENSEMBL: ENSMUSP00000149790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214889]
AlphaFold Q9D541
Predicted Effect probably damaging
Transcript: ENSMUST00000214889
AA Change: D648V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Ccdc7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Ccdc7a APN 8 129,753,235 (GRCm39) splice site probably benign
IGL01019:Ccdc7a APN 8 129,788,099 (GRCm39) missense probably benign 0.05
IGL01553:Ccdc7a APN 8 129,753,072 (GRCm39) splice site probably benign
IGL01577:Ccdc7a APN 8 129,715,244 (GRCm39) missense probably damaging 0.96
IGL03114:Ccdc7a APN 8 129,753,170 (GRCm39) missense possibly damaging 0.62
IGL03323:Ccdc7a APN 8 129,785,244 (GRCm39) missense probably benign 0.02
R1517:Ccdc7a UTSW 8 129,788,162 (GRCm39) missense probably damaging 0.99
R1804:Ccdc7a UTSW 8 129,715,247 (GRCm39) nonsense probably null
R1957:Ccdc7a UTSW 8 129,706,616 (GRCm39) missense probably damaging 0.99
R4926:Ccdc7a UTSW 8 129,706,535 (GRCm39) intron probably benign
R4981:Ccdc7a UTSW 8 129,711,464 (GRCm39) missense probably benign 0.35
R5193:Ccdc7a UTSW 8 129,715,278 (GRCm39) missense probably benign 0.02
R5273:Ccdc7a UTSW 8 129,788,090 (GRCm39) frame shift probably null
R5486:Ccdc7a UTSW 8 129,711,884 (GRCm39) missense probably damaging 0.98
R5505:Ccdc7a UTSW 8 129,706,655 (GRCm39) missense possibly damaging 0.73
R5562:Ccdc7a UTSW 8 129,785,266 (GRCm39) missense possibly damaging 0.79
R5704:Ccdc7a UTSW 8 129,706,577 (GRCm39) splice site probably benign
R6256:Ccdc7a UTSW 8 129,662,074 (GRCm39) splice site probably null
R6273:Ccdc7a UTSW 8 129,513,819 (GRCm39) missense probably damaging 0.97
R6366:Ccdc7a UTSW 8 129,582,473 (GRCm39) missense unknown
R6455:Ccdc7a UTSW 8 129,559,091 (GRCm39) missense probably damaging 0.97
R6778:Ccdc7a UTSW 8 129,547,601 (GRCm39) missense possibly damaging 0.66
R6882:Ccdc7a UTSW 8 129,523,809 (GRCm39) intron probably benign
R6891:Ccdc7a UTSW 8 129,753,119 (GRCm39) missense probably damaging 1.00
R6906:Ccdc7a UTSW 8 129,662,162 (GRCm39) missense unknown
R7028:Ccdc7a UTSW 8 129,608,075 (GRCm39) missense unknown
R7046:Ccdc7a UTSW 8 129,774,100 (GRCm39) missense probably damaging 0.99
R7073:Ccdc7a UTSW 8 129,618,866 (GRCm39) missense possibly damaging 0.46
R7268:Ccdc7a UTSW 8 129,607,633 (GRCm39) missense possibly damaging 0.66
R7454:Ccdc7a UTSW 8 129,670,997 (GRCm39) missense unknown
R7643:Ccdc7a UTSW 8 129,616,292 (GRCm39) missense probably damaging 1.00
R7733:Ccdc7a UTSW 8 129,719,533 (GRCm39) missense probably damaging 1.00
R7792:Ccdc7a UTSW 8 129,618,918 (GRCm39) missense possibly damaging 0.81
R7902:Ccdc7a UTSW 8 129,562,654 (GRCm39) missense possibly damaging 0.46
R7946:Ccdc7a UTSW 8 129,643,627 (GRCm39) missense probably damaging 0.97
R7983:Ccdc7a UTSW 8 129,607,559 (GRCm39) missense possibly damaging 0.66
R8032:Ccdc7a UTSW 8 129,551,864 (GRCm39) missense unknown
R8108:Ccdc7a UTSW 8 129,706,634 (GRCm39) missense unknown
R8345:Ccdc7a UTSW 8 129,525,245 (GRCm39) missense probably benign 0.01
R8372:Ccdc7a UTSW 8 129,547,585 (GRCm39) missense possibly damaging 0.82
R8379:Ccdc7a UTSW 8 129,691,417 (GRCm39) missense probably benign 0.03
R8472:Ccdc7a UTSW 8 129,754,138 (GRCm39) missense probably damaging 0.99
R8478:Ccdc7a UTSW 8 129,487,850 (GRCm39) missense possibly damaging 0.66
R8536:Ccdc7a UTSW 8 129,516,601 (GRCm39) missense possibly damaging 0.66
R8696:Ccdc7a UTSW 8 129,715,244 (GRCm39) missense probably damaging 0.96
R8813:Ccdc7a UTSW 8 129,549,942 (GRCm39) missense possibly damaging 0.83
R8859:Ccdc7a UTSW 8 129,788,113 (GRCm39) missense probably benign 0.44
R9208:Ccdc7a UTSW 8 129,472,482 (GRCm39) missense possibly damaging 0.66
R9222:Ccdc7a UTSW 8 129,525,610 (GRCm39) missense unknown
R9262:Ccdc7a UTSW 8 129,486,277 (GRCm39) missense possibly damaging 0.66
R9299:Ccdc7a UTSW 8 129,616,319 (GRCm39) missense probably benign 0.27
R9337:Ccdc7a UTSW 8 129,616,319 (GRCm39) missense probably benign 0.27
R9357:Ccdc7a UTSW 8 129,671,136 (GRCm39) critical splice acceptor site probably null
R9516:Ccdc7a UTSW 8 129,555,774 (GRCm39) missense unknown
R9579:Ccdc7a UTSW 8 129,774,134 (GRCm39) nonsense probably null
R9672:Ccdc7a UTSW 8 129,671,016 (GRCm39) missense unknown
R9777:Ccdc7a UTSW 8 129,618,860 (GRCm39) missense possibly damaging 0.90
RF008:Ccdc7a UTSW 8 129,691,434 (GRCm39) missense probably damaging 0.99
Z1176:Ccdc7a UTSW 8 129,753,144 (GRCm39) missense probably benign 0.41
Z1177:Ccdc7a UTSW 8 129,534,405 (GRCm39) missense possibly damaging 0.66
Z1190:Ccdc7a UTSW 8 129,546,376 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AAGAGGTAGACATGTAACTATGTGC -3'
(R):5'- TCACAAAGGGCAATGGTGTG -3'

Sequencing Primer
(F):5'- ACCTGCTGAAGAGCCTAA -3'
(R):5'- GCAATGGTGTGGAAAACTTGTC -3'
Posted On 2021-03-08