Incidental Mutation 'R8671:Thsd4'
ID 661166
Institutional Source Beutler Lab
Gene Symbol Thsd4
Ensembl Gene ENSMUSG00000032289
Gene Name thrombospondin, type I, domain containing 4
Synonyms B230114P05Rik, ADAMTSL6
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 59874214-60429329 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60301728 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 189 (L189H)
Ref Sequence ENSEMBL: ENSMUSP00000096257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098660] [ENSMUST00000171654]
AlphaFold Q3UTY6
Predicted Effect probably damaging
Transcript: ENSMUST00000098660
AA Change: L189H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096257
Gene: ENSMUSG00000032289
AA Change: L189H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Pfam:ADAM_spacer1 412 528 1.5e-39 PFAM
low complexity region 549 565 N/A INTRINSIC
TSP1 621 677 1.51e-1 SMART
TSP1 679 737 8.11e-5 SMART
TSP1 739 794 7.92e-8 SMART
TSP1 796 851 1.6e-3 SMART
TSP1 855 913 4.82e-2 SMART
TSP1 916 968 1.03e-6 SMART
Pfam:PLAC 974 1006 4.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171654
AA Change: L189H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131418
Gene: ENSMUSG00000032289
AA Change: L189H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Pfam:ADAM_spacer1 412 528 5.4e-40 PFAM
low complexity region 549 565 N/A INTRINSIC
TSP1 621 677 1.51e-1 SMART
TSP1 679 737 8.11e-5 SMART
TSP1 739 794 7.92e-8 SMART
TSP1 796 851 1.6e-3 SMART
TSP1 855 913 4.82e-2 SMART
TSP1 916 968 1.03e-6 SMART
Pfam:PLAC 975 1005 1.3e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Thsd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Thsd4 APN 9 60,301,398 (GRCm39) missense probably benign 0.22
IGL02418:Thsd4 APN 9 60,335,598 (GRCm39) missense probably damaging 0.99
IGL02491:Thsd4 APN 9 59,907,301 (GRCm39) missense probably damaging 0.99
IGL02754:Thsd4 APN 9 59,896,380 (GRCm39) splice site probably benign
IGL02874:Thsd4 APN 9 60,160,013 (GRCm39) missense probably damaging 1.00
IGL02978:Thsd4 APN 9 59,964,129 (GRCm39) splice site probably null
IGL03139:Thsd4 APN 9 59,904,456 (GRCm39) missense probably benign 0.01
R0266:Thsd4 UTSW 9 59,904,417 (GRCm39) missense probably benign 0.07
R0482:Thsd4 UTSW 9 59,910,261 (GRCm39) missense probably damaging 1.00
R1188:Thsd4 UTSW 9 60,301,689 (GRCm39) missense probably benign 0.12
R1447:Thsd4 UTSW 9 59,904,496 (GRCm39) missense probably benign
R1572:Thsd4 UTSW 9 60,301,836 (GRCm39) splice site probably benign
R1812:Thsd4 UTSW 9 59,964,220 (GRCm39) missense probably damaging 1.00
R2349:Thsd4 UTSW 9 59,879,798 (GRCm39) missense probably benign 0.05
R3236:Thsd4 UTSW 9 60,301,670 (GRCm39) missense probably benign
R4088:Thsd4 UTSW 9 59,904,505 (GRCm39) missense probably benign 0.02
R4884:Thsd4 UTSW 9 59,895,320 (GRCm39) missense probably benign 0.43
R4886:Thsd4 UTSW 9 59,896,313 (GRCm39) missense probably benign 0.00
R5066:Thsd4 UTSW 9 59,883,615 (GRCm39) missense probably damaging 1.00
R5223:Thsd4 UTSW 9 59,964,325 (GRCm39) missense probably damaging 1.00
R5441:Thsd4 UTSW 9 59,887,066 (GRCm39) missense probably damaging 1.00
R5457:Thsd4 UTSW 9 59,887,060 (GRCm39) missense probably damaging 1.00
R5574:Thsd4 UTSW 9 59,879,683 (GRCm39) missense probably damaging 1.00
R5581:Thsd4 UTSW 9 59,879,741 (GRCm39) missense possibly damaging 0.90
R5903:Thsd4 UTSW 9 60,301,389 (GRCm39) missense possibly damaging 0.47
R6220:Thsd4 UTSW 9 59,890,030 (GRCm39) missense probably damaging 1.00
R6728:Thsd4 UTSW 9 59,904,480 (GRCm39) missense probably benign
R7102:Thsd4 UTSW 9 59,883,587 (GRCm39) missense probably damaging 1.00
R7316:Thsd4 UTSW 9 59,894,642 (GRCm39) missense probably benign 0.00
R7403:Thsd4 UTSW 9 59,964,170 (GRCm39) missense probably damaging 0.99
R7638:Thsd4 UTSW 9 60,301,755 (GRCm39) missense probably damaging 1.00
R7671:Thsd4 UTSW 9 60,335,457 (GRCm39) missense probably benign
R7856:Thsd4 UTSW 9 59,910,144 (GRCm39) missense probably damaging 1.00
R9104:Thsd4 UTSW 9 59,964,179 (GRCm39) missense possibly damaging 0.95
R9182:Thsd4 UTSW 9 59,894,649 (GRCm39) missense probably benign 0.00
R9252:Thsd4 UTSW 9 59,964,230 (GRCm39) missense probably benign 0.04
R9663:Thsd4 UTSW 9 59,890,026 (GRCm39) missense probably damaging 1.00
Z1177:Thsd4 UTSW 9 59,895,377 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGTGGAAGAGACTCGACG -3'
(R):5'- TCTCTTCTGAGCCATGGGTC -3'

Sequencing Primer
(F):5'- CGACGCTGCAGGATAGCTTTG -3'
(R):5'- TTCTGAGCCATGGGTCCAGAG -3'
Posted On 2021-03-08