Incidental Mutation 'R8671:Ankrd36'
ID 661168
Institutional Source Beutler Lab
Gene Symbol Ankrd36
Ensembl Gene ENSMUSG00000020481
Gene Name ankyrin repeat domain 36
Synonyms GC3, 1700012M14Rik, 1700008J08Rik
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 5519684-5639337 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 5579312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 192 (A192V)
Ref Sequence ENSEMBL: ENSMUSP00000120499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109856] [ENSMUST00000118112] [ENSMUST00000137933]
AlphaFold D3Z4K0
Predicted Effect probably benign
Transcript: ENSMUST00000109856
AA Change: A835V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105482
Gene: ENSMUSG00000020481
AA Change: A835V

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 4.5e-3 SMART
ANK 99 128 1.44e-1 SMART
ANK 132 161 4.6e0 SMART
ANK 165 194 2.48e-5 SMART
ANK 198 227 4.67e-1 SMART
internal_repeat_1 449 555 1.04e-5 PROSPERO
internal_repeat_1 891 981 1.04e-5 PROSPERO
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1268 1297 N/A INTRINSIC
coiled coil region 1318 1338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118112
AA Change: A867V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122397
Gene: ENSMUSG00000020481
AA Change: A867V

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 2.9e-5 SMART
ANK 99 128 9.4e-4 SMART
ANK 132 161 2.9e-2 SMART
ANK 165 194 1.5e-7 SMART
ANK 198 227 2.9e-3 SMART
internal_repeat_1 255 352 8.15e-5 PROSPERO
internal_repeat_1 438 538 8.15e-5 PROSPERO
low complexity region 1138 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137933
AA Change: A192V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120499
Gene: ENSMUSG00000020481
AA Change: A192V

DomainStartEndE-ValueType
low complexity region 463 476 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Ankrd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ankrd36 APN 11 5,570,131 (GRCm39) missense probably benign 0.01
IGL01361:Ankrd36 APN 11 5,546,706 (GRCm39) splice site probably benign
IGL01370:Ankrd36 APN 11 5,534,019 (GRCm39) missense probably benign 0.06
IGL01384:Ankrd36 APN 11 5,578,348 (GRCm39) missense probably benign 0.33
IGL01484:Ankrd36 APN 11 5,579,006 (GRCm39) missense possibly damaging 0.90
IGL01524:Ankrd36 APN 11 5,585,092 (GRCm39) missense probably benign
IGL01700:Ankrd36 APN 11 5,582,198 (GRCm39) missense probably benign 0.05
IGL02322:Ankrd36 APN 11 5,564,619 (GRCm39) missense possibly damaging 0.86
IGL02511:Ankrd36 APN 11 5,610,845 (GRCm39) splice site probably null
IGL02824:Ankrd36 APN 11 5,524,246 (GRCm39) missense possibly damaging 0.67
IGL03204:Ankrd36 APN 11 5,534,023 (GRCm39) missense possibly damaging 0.70
PIT4508001:Ankrd36 UTSW 11 5,557,137 (GRCm39) missense possibly damaging 0.53
R0058:Ankrd36 UTSW 11 5,580,691 (GRCm39) splice site probably benign
R0058:Ankrd36 UTSW 11 5,580,691 (GRCm39) splice site probably benign
R0304:Ankrd36 UTSW 11 5,578,981 (GRCm39) missense possibly damaging 0.55
R0504:Ankrd36 UTSW 11 5,579,274 (GRCm39) missense probably damaging 0.99
R0550:Ankrd36 UTSW 11 5,557,429 (GRCm39) critical splice donor site probably null
R0563:Ankrd36 UTSW 11 5,579,322 (GRCm39) missense probably benign 0.33
R0891:Ankrd36 UTSW 11 5,637,316 (GRCm39) missense possibly damaging 0.72
R1018:Ankrd36 UTSW 11 5,596,876 (GRCm39) unclassified probably benign
R1468:Ankrd36 UTSW 11 5,525,752 (GRCm39) missense probably damaging 0.99
R1468:Ankrd36 UTSW 11 5,525,752 (GRCm39) missense probably damaging 0.99
R1558:Ankrd36 UTSW 11 5,585,329 (GRCm39) missense probably damaging 0.99
R1663:Ankrd36 UTSW 11 5,570,126 (GRCm39) missense possibly damaging 0.70
R1682:Ankrd36 UTSW 11 5,557,143 (GRCm39) missense possibly damaging 0.84
R1898:Ankrd36 UTSW 11 5,525,683 (GRCm39) missense probably benign 0.33
R2019:Ankrd36 UTSW 11 5,639,140 (GRCm39) missense probably benign
R2032:Ankrd36 UTSW 11 5,578,616 (GRCm39) missense possibly damaging 0.86
R2084:Ankrd36 UTSW 11 5,612,378 (GRCm39) nonsense probably null
R4097:Ankrd36 UTSW 11 5,578,703 (GRCm39) missense possibly damaging 0.85
R4572:Ankrd36 UTSW 11 5,639,340 (GRCm39) splice site probably null
R4601:Ankrd36 UTSW 11 5,520,102 (GRCm39) missense probably benign 0.04
R4770:Ankrd36 UTSW 11 5,540,870 (GRCm39) missense possibly damaging 0.73
R4777:Ankrd36 UTSW 11 5,557,120 (GRCm39) missense probably benign
R4894:Ankrd36 UTSW 11 5,585,332 (GRCm39) missense probably damaging 0.98
R5288:Ankrd36 UTSW 11 5,639,340 (GRCm39) unclassified probably benign
R5366:Ankrd36 UTSW 11 5,542,841 (GRCm39) nonsense probably null
R5384:Ankrd36 UTSW 11 5,639,340 (GRCm39) unclassified probably benign
R5385:Ankrd36 UTSW 11 5,639,340 (GRCm39) unclassified probably benign
R6109:Ankrd36 UTSW 11 5,578,941 (GRCm39) missense probably damaging 0.98
R6155:Ankrd36 UTSW 11 5,637,442 (GRCm39) missense probably benign 0.00
R6186:Ankrd36 UTSW 11 5,593,812 (GRCm39) missense possibly damaging 0.81
R6289:Ankrd36 UTSW 11 5,578,837 (GRCm39) missense probably damaging 0.96
R6476:Ankrd36 UTSW 11 5,578,753 (GRCm39) missense probably benign 0.05
R6816:Ankrd36 UTSW 11 5,593,765 (GRCm39) missense possibly damaging 0.66
R6880:Ankrd36 UTSW 11 5,578,748 (GRCm39) missense probably damaging 0.99
R6919:Ankrd36 UTSW 11 5,579,299 (GRCm39) missense probably benign
R7007:Ankrd36 UTSW 11 5,639,168 (GRCm39) missense probably benign 0.00
R7515:Ankrd36 UTSW 11 5,578,905 (GRCm39) missense possibly damaging 0.94
R7617:Ankrd36 UTSW 11 5,637,348 (GRCm39) missense probably benign 0.33
R7684:Ankrd36 UTSW 11 5,520,113 (GRCm39) missense possibly damaging 0.49
R7746:Ankrd36 UTSW 11 5,637,451 (GRCm39) missense possibly damaging 0.96
R7783:Ankrd36 UTSW 11 5,585,359 (GRCm39) missense probably damaging 0.99
R7790:Ankrd36 UTSW 11 5,585,176 (GRCm39) missense possibly damaging 0.80
R8221:Ankrd36 UTSW 11 5,534,016 (GRCm39) missense possibly damaging 0.53
R8732:Ankrd36 UTSW 11 5,578,906 (GRCm39) missense possibly damaging 0.90
R8768:Ankrd36 UTSW 11 5,593,763 (GRCm39) missense probably benign 0.00
R9026:Ankrd36 UTSW 11 5,610,696 (GRCm39) missense probably benign
R9093:Ankrd36 UTSW 11 5,589,132 (GRCm39) missense probably benign
R9211:Ankrd36 UTSW 11 5,612,370 (GRCm39) missense possibly damaging 0.85
R9300:Ankrd36 UTSW 11 5,519,979 (GRCm39) missense possibly damaging 0.84
R9644:Ankrd36 UTSW 11 5,593,835 (GRCm39) missense possibly damaging 0.90
RF004:Ankrd36 UTSW 11 5,612,411 (GRCm39) missense possibly damaging 0.53
U24488:Ankrd36 UTSW 11 5,580,772 (GRCm39) missense probably damaging 0.99
Z1176:Ankrd36 UTSW 11 5,565,538 (GRCm39) missense probably benign
Z1177:Ankrd36 UTSW 11 5,593,738 (GRCm39) missense probably damaging 0.96
Z1177:Ankrd36 UTSW 11 5,579,345 (GRCm39) missense probably benign 0.01
Z1177:Ankrd36 UTSW 11 5,521,117 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAGTTGGGGTGATTCTGCCC -3'
(R):5'- ACGGTGTTACGTTCCTTTGC -3'

Sequencing Primer
(F):5'- CCTTGCAAGCGACATGTACAGG -3'
(R):5'- GTCTACAAGGCTACACAATCTCATG -3'
Posted On 2021-03-08