Incidental Mutation 'R8671:Ankrd36'
ID661168
Institutional Source Beutler Lab
Gene Symbol Ankrd36
Ensembl Gene ENSMUSG00000020481
Gene Nameankyrin repeat domain 36
Synonyms1700012M14Rik, 1700008J08Rik, GC3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R8671 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location5569684-5689337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5629312 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 192 (A192V)
Ref Sequence ENSEMBL: ENSMUSP00000120499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109856] [ENSMUST00000118112] [ENSMUST00000137933]
Predicted Effect probably benign
Transcript: ENSMUST00000109856
AA Change: A835V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105482
Gene: ENSMUSG00000020481
AA Change: A835V

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 4.5e-3 SMART
ANK 99 128 1.44e-1 SMART
ANK 132 161 4.6e0 SMART
ANK 165 194 2.48e-5 SMART
ANK 198 227 4.67e-1 SMART
internal_repeat_1 449 555 1.04e-5 PROSPERO
internal_repeat_1 891 981 1.04e-5 PROSPERO
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1268 1297 N/A INTRINSIC
coiled coil region 1318 1338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118112
AA Change: A867V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122397
Gene: ENSMUSG00000020481
AA Change: A867V

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 2.9e-5 SMART
ANK 99 128 9.4e-4 SMART
ANK 132 161 2.9e-2 SMART
ANK 165 194 1.5e-7 SMART
ANK 198 227 2.9e-3 SMART
internal_repeat_1 255 352 8.15e-5 PROSPERO
internal_repeat_1 438 538 8.15e-5 PROSPERO
low complexity region 1138 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137933
AA Change: A192V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120499
Gene: ENSMUSG00000020481
AA Change: A192V

DomainStartEndE-ValueType
low complexity region 463 476 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,942,929 E145K probably damaging Het
4930430A15Rik T C 2: 111,229,532 probably benign Het
4930467E23Rik T A 8: 19,734,759 L203* probably null Het
Ambp A T 4: 63,150,419 Y120* probably null Het
Apol7e A T 15: 77,717,603 M134L probably benign Het
Atg9b A T 5: 24,386,109 N774K probably benign Het
BC027072 G T 17: 71,751,377 A435E probably benign Het
Catsperb T A 12: 101,594,337 N862K possibly damaging Het
Ccdc7a T A 8: 128,920,467 D648V probably damaging Het
Cfap54 G T 10: 92,955,072 P1855T unknown Het
Clcnkb T A 4: 141,412,230 T154S probably damaging Het
Cux1 C T 5: 136,250,600 R609H probably damaging Het
Eif2ak4 A G 2: 118,422,186 D413G possibly damaging Het
Flnc T C 6: 29,443,502 probably null Het
Grm5 T C 7: 88,116,290 probably null Het
Hectd3 T G 4: 116,996,581 F225V possibly damaging Het
Hpcal4 G T 4: 123,189,183 M107I probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ikbkap A G 4: 56,771,453 L948P probably damaging Het
Larp4 C A 15: 100,010,458 Q607K probably benign Het
March8 A G 6: 116,401,854 R250G probably benign Het
Med13 A C 11: 86,271,097 N2135K probably damaging Het
Msh5 T A 17: 35,045,933 R89* probably null Het
Musk T G 4: 58,286,051 probably benign Het
Myo18b T C 5: 112,874,743 Q261R unknown Het
Npr1 A T 3: 90,456,157 probably benign Het
Nynrin T A 14: 55,870,442 V1002E possibly damaging Het
Olfr1138 A T 2: 87,737,646 L226Q probably damaging Het
Olfr1195 A T 2: 88,683,105 F209Y probably benign Het
Olfr1315-ps1 T A 2: 112,110,988 K88M probably damaging Het
Olfr167 T C 16: 19,515,054 Y194C possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prkd1 T A 12: 50,388,408 N512I probably benign Het
Pwwp2b C T 7: 139,256,410 P589L probably damaging Het
Rasgrp4 G A 7: 29,143,027 G242D probably damaging Het
Rcbtb1 T G 14: 59,230,524 V480G probably damaging Het
Rptn A G 3: 93,398,194 S945G probably benign Het
Slc22a2 C T 17: 12,605,976 Q242* probably null Het
Slfn3 T A 11: 83,212,999 V232E probably benign Het
Stab1 T A 14: 31,157,408 K705M probably damaging Het
Syn2 C A 6: 115,278,167 S480* probably null Het
Thsd4 A T 9: 60,394,445 L189H probably damaging Het
Tinagl1 T C 4: 130,167,804 T250A probably benign Het
Tnc A T 4: 64,017,446 C418S probably damaging Het
Ube2q1 A G 3: 89,776,078 E110G probably damaging Het
Wdfy4 G T 14: 32,971,765 probably benign Het
Xcl1 T C 1: 164,931,850 M94V probably benign Het
Zfp369 T C 13: 65,296,281 S413P possibly damaging Het
Zfp454 A C 11: 50,873,768 I279S possibly damaging Het
Zfp971 A C 2: 178,033,937 Q443P probably damaging Het
Other mutations in Ankrd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ankrd36 APN 11 5620131 missense probably benign 0.01
IGL01361:Ankrd36 APN 11 5596706 splice site probably benign
IGL01370:Ankrd36 APN 11 5584019 missense probably benign 0.06
IGL01384:Ankrd36 APN 11 5628348 missense probably benign 0.33
IGL01484:Ankrd36 APN 11 5629006 missense possibly damaging 0.90
IGL01524:Ankrd36 APN 11 5635092 missense probably benign
IGL01700:Ankrd36 APN 11 5632198 missense probably benign 0.05
IGL02322:Ankrd36 APN 11 5614619 missense possibly damaging 0.86
IGL02511:Ankrd36 APN 11 5660845 splice site probably null
IGL02824:Ankrd36 APN 11 5574246 missense possibly damaging 0.67
IGL03204:Ankrd36 APN 11 5584023 missense possibly damaging 0.70
PIT4508001:Ankrd36 UTSW 11 5607137 missense possibly damaging 0.53
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0304:Ankrd36 UTSW 11 5628981 missense possibly damaging 0.55
R0504:Ankrd36 UTSW 11 5629274 missense probably damaging 0.99
R0550:Ankrd36 UTSW 11 5607429 critical splice donor site probably null
R0563:Ankrd36 UTSW 11 5629322 missense probably benign 0.33
R0891:Ankrd36 UTSW 11 5687316 missense possibly damaging 0.72
R1018:Ankrd36 UTSW 11 5646876 unclassified probably benign
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1558:Ankrd36 UTSW 11 5635329 missense probably damaging 0.99
R1663:Ankrd36 UTSW 11 5620126 missense possibly damaging 0.70
R1682:Ankrd36 UTSW 11 5607143 missense possibly damaging 0.84
R1898:Ankrd36 UTSW 11 5575683 missense probably benign 0.33
R2019:Ankrd36 UTSW 11 5689140 missense probably benign
R2032:Ankrd36 UTSW 11 5628616 missense possibly damaging 0.86
R2084:Ankrd36 UTSW 11 5662378 nonsense probably null
R4097:Ankrd36 UTSW 11 5628703 missense possibly damaging 0.85
R4572:Ankrd36 UTSW 11 5689340 splice site probably null
R4601:Ankrd36 UTSW 11 5570102 missense probably benign 0.04
R4770:Ankrd36 UTSW 11 5590870 missense possibly damaging 0.73
R4777:Ankrd36 UTSW 11 5607120 missense probably benign
R4894:Ankrd36 UTSW 11 5635332 missense probably damaging 0.98
R5288:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5366:Ankrd36 UTSW 11 5592841 nonsense probably null
R5384:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5385:Ankrd36 UTSW 11 5689340 unclassified probably benign
R6109:Ankrd36 UTSW 11 5628941 missense probably damaging 0.98
R6155:Ankrd36 UTSW 11 5687442 missense probably benign 0.00
R6186:Ankrd36 UTSW 11 5643812 missense possibly damaging 0.81
R6289:Ankrd36 UTSW 11 5628837 missense probably damaging 0.96
R6476:Ankrd36 UTSW 11 5628753 missense probably benign 0.05
R6816:Ankrd36 UTSW 11 5643765 missense possibly damaging 0.66
R6880:Ankrd36 UTSW 11 5628748 missense probably damaging 0.99
R6919:Ankrd36 UTSW 11 5629299 missense probably benign
R7007:Ankrd36 UTSW 11 5689168 missense probably benign 0.00
R7515:Ankrd36 UTSW 11 5628905 missense possibly damaging 0.94
R7617:Ankrd36 UTSW 11 5687348 missense probably benign 0.33
R7684:Ankrd36 UTSW 11 5570113 missense possibly damaging 0.49
R7746:Ankrd36 UTSW 11 5687451 missense possibly damaging 0.96
R7783:Ankrd36 UTSW 11 5635359 missense probably damaging 0.99
R7790:Ankrd36 UTSW 11 5635176 missense possibly damaging 0.80
R8221:Ankrd36 UTSW 11 5584016 missense possibly damaging 0.53
R8732:Ankrd36 UTSW 11 5628906 missense possibly damaging 0.90
R8768:Ankrd36 UTSW 11 5643763 missense probably benign 0.00
RF004:Ankrd36 UTSW 11 5662411 missense possibly damaging 0.53
U24488:Ankrd36 UTSW 11 5630772 missense probably damaging 0.99
Z1176:Ankrd36 UTSW 11 5615538 missense probably benign
Z1177:Ankrd36 UTSW 11 5571117 missense probably damaging 0.97
Z1177:Ankrd36 UTSW 11 5629345 missense probably benign 0.01
Z1177:Ankrd36 UTSW 11 5643738 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAAGTTGGGGTGATTCTGCCC -3'
(R):5'- ACGGTGTTACGTTCCTTTGC -3'

Sequencing Primer
(F):5'- CCTTGCAAGCGACATGTACAGG -3'
(R):5'- GTCTACAAGGCTACACAATCTCATG -3'
Posted On2021-03-08