Incidental Mutation 'R8671:Med13'
ID661171
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Namemediator complex subunit 13
SynonymsThrap1, 1110067M05Rik, Trap240
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R8671 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location86267033-86357602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86271097 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2135 (N2135K)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
Predicted Effect probably damaging
Transcript: ENSMUST00000043624
AA Change: N2135K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: N2135K

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Meta Mutation Damage Score 0.3345 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,942,929 E145K probably damaging Het
4930430A15Rik T C 2: 111,229,532 probably benign Het
4930467E23Rik T A 8: 19,734,759 L203* probably null Het
Ambp A T 4: 63,150,419 Y120* probably null Het
Ankrd36 C T 11: 5,629,312 A192V probably benign Het
Apol7e A T 15: 77,717,603 M134L probably benign Het
Atg9b A T 5: 24,386,109 N774K probably benign Het
BC027072 G T 17: 71,751,377 A435E probably benign Het
Catsperb T A 12: 101,594,337 N862K possibly damaging Het
Ccdc7a T A 8: 128,920,467 D648V probably damaging Het
Cfap54 G T 10: 92,955,072 P1855T unknown Het
Clcnkb T A 4: 141,412,230 T154S probably damaging Het
Cux1 C T 5: 136,250,600 R609H probably damaging Het
Eif2ak4 A G 2: 118,422,186 D413G possibly damaging Het
Flnc T C 6: 29,443,502 probably null Het
Grm5 T C 7: 88,116,290 probably null Het
Hectd3 T G 4: 116,996,581 F225V possibly damaging Het
Hpcal4 G T 4: 123,189,183 M107I probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ikbkap A G 4: 56,771,453 L948P probably damaging Het
Larp4 C A 15: 100,010,458 Q607K probably benign Het
March8 A G 6: 116,401,854 R250G probably benign Het
Msh5 T A 17: 35,045,933 R89* probably null Het
Musk T G 4: 58,286,051 probably benign Het
Myo18b T C 5: 112,874,743 Q261R unknown Het
Npr1 A T 3: 90,456,157 probably benign Het
Nynrin T A 14: 55,870,442 V1002E possibly damaging Het
Olfr1138 A T 2: 87,737,646 L226Q probably damaging Het
Olfr1195 A T 2: 88,683,105 F209Y probably benign Het
Olfr1315-ps1 T A 2: 112,110,988 K88M probably damaging Het
Olfr167 T C 16: 19,515,054 Y194C possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prkd1 T A 12: 50,388,408 N512I probably benign Het
Pwwp2b C T 7: 139,256,410 P589L probably damaging Het
Rasgrp4 G A 7: 29,143,027 G242D probably damaging Het
Rcbtb1 T G 14: 59,230,524 V480G probably damaging Het
Rptn A G 3: 93,398,194 S945G probably benign Het
Slc22a2 C T 17: 12,605,976 Q242* probably null Het
Slfn3 T A 11: 83,212,999 V232E probably benign Het
Stab1 T A 14: 31,157,408 K705M probably damaging Het
Syn2 C A 6: 115,278,167 S480* probably null Het
Thsd4 A T 9: 60,394,445 L189H probably damaging Het
Tinagl1 T C 4: 130,167,804 T250A probably benign Het
Tnc A T 4: 64,017,446 C418S probably damaging Het
Ube2q1 A G 3: 89,776,078 E110G probably damaging Het
Wdfy4 G T 14: 32,971,765 probably benign Het
Xcl1 T C 1: 164,931,850 M94V probably benign Het
Zfp369 T C 13: 65,296,281 S413P possibly damaging Het
Zfp454 A C 11: 50,873,768 I279S possibly damaging Het
Zfp971 A C 2: 178,033,937 Q443P probably damaging Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86291040 splice site probably benign
IGL01391:Med13 APN 11 86328497 missense probably benign
IGL01767:Med13 APN 11 86319783 missense probably benign 0.38
IGL01830:Med13 APN 11 86288928 splice site probably benign
IGL01859:Med13 APN 11 86283751 missense possibly damaging 0.86
IGL01924:Med13 APN 11 86308696 splice site probably benign
IGL02080:Med13 APN 11 86283812 missense probably damaging 0.97
IGL02138:Med13 APN 11 86286765 missense probably damaging 0.99
IGL02259:Med13 APN 11 86357501 missense possibly damaging 0.89
IGL02339:Med13 APN 11 86288939 missense probably benign 0.16
IGL02399:Med13 APN 11 86283945 splice site probably benign
IGL02646:Med13 APN 11 86283386 missense probably benign 0.00
IGL03227:Med13 APN 11 86327792 splice site probably benign
R0197_Med13_854 UTSW 11 86307038 missense probably benign 0.13
R0360_Med13_060 UTSW 11 86329161 splice site probably benign
R2359_Med13_079 UTSW 11 86291035 splice site probably benign
R3735_Med13_085 UTSW 11 86279658 missense probably benign 0.00
R4974_Med13_508 UTSW 11 86298847 missense probably damaging 0.98
R0116:Med13 UTSW 11 86319897 missense probably damaging 0.99
R0189:Med13 UTSW 11 86319876 missense probably benign
R0197:Med13 UTSW 11 86307038 missense probably benign 0.13
R0206:Med13 UTSW 11 86300856 splice site probably benign
R0208:Med13 UTSW 11 86300856 splice site probably benign
R0310:Med13 UTSW 11 86346003 missense probably benign 0.11
R0360:Med13 UTSW 11 86329161 splice site probably benign
R0413:Med13 UTSW 11 86299207 splice site probably benign
R0482:Med13 UTSW 11 86285151 missense probably benign 0.41
R0497:Med13 UTSW 11 86276983 splice site probably benign
R0589:Med13 UTSW 11 86283249 missense probably damaging 1.00
R0601:Med13 UTSW 11 86345962 missense possibly damaging 0.47
R0646:Med13 UTSW 11 86331089 missense possibly damaging 0.95
R0701:Med13 UTSW 11 86307038 missense probably benign 0.13
R0709:Med13 UTSW 11 86319596 missense possibly damaging 0.95
R0711:Med13 UTSW 11 86301353 splice site probably benign
R0734:Med13 UTSW 11 86301237 missense probably benign
R0883:Med13 UTSW 11 86307038 missense probably benign 0.13
R1793:Med13 UTSW 11 86329351 missense probably benign 0.45
R1926:Med13 UTSW 11 86289073 missense possibly damaging 0.47
R1959:Med13 UTSW 11 86298979 missense probably damaging 1.00
R2286:Med13 UTSW 11 86319689 missense probably benign 0.05
R2359:Med13 UTSW 11 86291035 splice site probably benign
R2444:Med13 UTSW 11 86331960 missense probably damaging 1.00
R2679:Med13 UTSW 11 86298577 missense probably benign 0.00
R2879:Med13 UTSW 11 86299162 missense possibly damaging 0.61
R3439:Med13 UTSW 11 86285297 missense probably damaging 1.00
R3735:Med13 UTSW 11 86279658 missense probably benign 0.00
R4333:Med13 UTSW 11 86288183 missense probably benign
R4558:Med13 UTSW 11 86299054 missense probably damaging 1.00
R4598:Med13 UTSW 11 86278566 missense probably damaging 0.97
R4773:Med13 UTSW 11 86276920 missense probably damaging 0.99
R4801:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4802:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4806:Med13 UTSW 11 86298577 missense probably benign 0.00
R4940:Med13 UTSW 11 86288118 missense probably damaging 1.00
R4974:Med13 UTSW 11 86298847 missense probably damaging 0.98
R5056:Med13 UTSW 11 86328565 missense probably benign 0.00
R5133:Med13 UTSW 11 86319849 missense probably benign 0.32
R5206:Med13 UTSW 11 86319879 missense probably damaging 1.00
R5352:Med13 UTSW 11 86301468 missense possibly damaging 0.82
R5534:Med13 UTSW 11 86319365 missense probably benign 0.09
R5556:Med13 UTSW 11 86327838 missense probably benign 0.25
R5633:Med13 UTSW 11 86278931 splice site probably benign
R5769:Med13 UTSW 11 86346003 missense probably benign 0.11
R6236:Med13 UTSW 11 86328531 missense probably damaging 0.99
R6479:Med13 UTSW 11 86357527 start gained probably benign
R6487:Med13 UTSW 11 86331150 missense probably damaging 1.00
R6524:Med13 UTSW 11 86301467 missense probably damaging 0.98
R6528:Med13 UTSW 11 86298954 missense probably damaging 1.00
R6805:Med13 UTSW 11 86278796 missense possibly damaging 0.48
R6913:Med13 UTSW 11 86319876 missense probably benign
R7221:Med13 UTSW 11 86288095 missense probably benign 0.00
R7254:Med13 UTSW 11 86319835 missense probably benign
R7267:Med13 UTSW 11 86308826 missense probably benign 0.01
R7309:Med13 UTSW 11 86291062 missense probably benign 0.00
R7404:Med13 UTSW 11 86286446 missense possibly damaging 0.53
R7586:Med13 UTSW 11 86271002 missense probably damaging 0.99
R7704:Med13 UTSW 11 86345918 nonsense probably null
R7922:Med13 UTSW 11 86271005 missense probably damaging 0.98
R7943:Med13 UTSW 11 86278526 missense probably damaging 0.97
R8062:Med13 UTSW 11 86319438 missense probably benign
R8075:Med13 UTSW 11 86272470 missense probably damaging 0.98
R8207:Med13 UTSW 11 86303549 missense probably damaging 1.00
Z1176:Med13 UTSW 11 86328544 missense possibly damaging 0.91
Z1176:Med13 UTSW 11 86345862 missense probably benign 0.45
Z1176:Med13 UTSW 11 86355423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAACTGTAACTTAATCTTGCAGC -3'
(R):5'- TGTTTAGGCAGCAAAGGGTG -3'

Sequencing Primer
(F):5'- GCAGCAAAATATCCTTTCTTCCCG -3'
(R):5'- CAGCAAAGGGTGTCTCTCTC -3'
Posted On2021-03-08