Incidental Mutation 'R8671:Med13'
ID 661171
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Name mediator complex subunit 13
Synonyms 1110067M05Rik, Thrap1, Trap240
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 86157859-86248422 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 86161923 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 2135 (N2135K)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
AlphaFold Q5SWW4
Predicted Effect probably damaging
Transcript: ENSMUST00000043624
AA Change: N2135K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: N2135K

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Meta Mutation Damage Score 0.3345 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86,181,866 (GRCm39) splice site probably benign
IGL01391:Med13 APN 11 86,219,323 (GRCm39) missense probably benign
IGL01767:Med13 APN 11 86,210,609 (GRCm39) missense probably benign 0.38
IGL01830:Med13 APN 11 86,179,754 (GRCm39) splice site probably benign
IGL01859:Med13 APN 11 86,174,577 (GRCm39) missense possibly damaging 0.86
IGL01924:Med13 APN 11 86,199,522 (GRCm39) splice site probably benign
IGL02080:Med13 APN 11 86,174,638 (GRCm39) missense probably damaging 0.97
IGL02138:Med13 APN 11 86,177,591 (GRCm39) missense probably damaging 0.99
IGL02259:Med13 APN 11 86,248,327 (GRCm39) missense possibly damaging 0.89
IGL02339:Med13 APN 11 86,179,765 (GRCm39) missense probably benign 0.16
IGL02399:Med13 APN 11 86,174,771 (GRCm39) splice site probably benign
IGL02646:Med13 APN 11 86,174,212 (GRCm39) missense probably benign 0.00
IGL03227:Med13 APN 11 86,218,618 (GRCm39) splice site probably benign
R0197_Med13_854 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0360_Med13_060 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R2359_Med13_079 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R3735_Med13_085 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4974_Med13_508 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R0116:Med13 UTSW 11 86,210,723 (GRCm39) missense probably damaging 0.99
R0189:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R0197:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0206:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0208:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0310:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R0360:Med13 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R0413:Med13 UTSW 11 86,190,033 (GRCm39) splice site probably benign
R0482:Med13 UTSW 11 86,175,977 (GRCm39) missense probably benign 0.41
R0497:Med13 UTSW 11 86,167,809 (GRCm39) splice site probably benign
R0589:Med13 UTSW 11 86,174,075 (GRCm39) missense probably damaging 1.00
R0601:Med13 UTSW 11 86,236,788 (GRCm39) missense possibly damaging 0.47
R0646:Med13 UTSW 11 86,221,915 (GRCm39) missense possibly damaging 0.95
R0701:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0709:Med13 UTSW 11 86,210,422 (GRCm39) missense possibly damaging 0.95
R0711:Med13 UTSW 11 86,192,179 (GRCm39) splice site probably benign
R0734:Med13 UTSW 11 86,192,063 (GRCm39) missense probably benign
R0883:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R1793:Med13 UTSW 11 86,220,177 (GRCm39) missense probably benign 0.45
R1926:Med13 UTSW 11 86,179,899 (GRCm39) missense possibly damaging 0.47
R1959:Med13 UTSW 11 86,189,805 (GRCm39) missense probably damaging 1.00
R2286:Med13 UTSW 11 86,210,515 (GRCm39) missense probably benign 0.05
R2359:Med13 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R2444:Med13 UTSW 11 86,222,786 (GRCm39) missense probably damaging 1.00
R2679:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R2879:Med13 UTSW 11 86,189,988 (GRCm39) missense possibly damaging 0.61
R3439:Med13 UTSW 11 86,176,123 (GRCm39) missense probably damaging 1.00
R3735:Med13 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4333:Med13 UTSW 11 86,179,009 (GRCm39) missense probably benign
R4558:Med13 UTSW 11 86,189,880 (GRCm39) missense probably damaging 1.00
R4598:Med13 UTSW 11 86,169,392 (GRCm39) missense probably damaging 0.97
R4773:Med13 UTSW 11 86,167,746 (GRCm39) missense probably damaging 0.99
R4801:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4802:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4806:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R4940:Med13 UTSW 11 86,178,944 (GRCm39) missense probably damaging 1.00
R4974:Med13 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R5056:Med13 UTSW 11 86,219,391 (GRCm39) missense probably benign 0.00
R5133:Med13 UTSW 11 86,210,675 (GRCm39) missense probably benign 0.32
R5206:Med13 UTSW 11 86,210,705 (GRCm39) missense probably damaging 1.00
R5352:Med13 UTSW 11 86,192,294 (GRCm39) missense possibly damaging 0.82
R5534:Med13 UTSW 11 86,210,191 (GRCm39) missense probably benign 0.09
R5556:Med13 UTSW 11 86,218,664 (GRCm39) missense probably benign 0.25
R5633:Med13 UTSW 11 86,169,757 (GRCm39) splice site probably benign
R5769:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R6236:Med13 UTSW 11 86,219,357 (GRCm39) missense probably damaging 0.99
R6479:Med13 UTSW 11 86,248,353 (GRCm39) start gained probably benign
R6487:Med13 UTSW 11 86,221,976 (GRCm39) missense probably damaging 1.00
R6524:Med13 UTSW 11 86,192,293 (GRCm39) missense probably damaging 0.98
R6528:Med13 UTSW 11 86,189,780 (GRCm39) missense probably damaging 1.00
R6805:Med13 UTSW 11 86,169,622 (GRCm39) missense possibly damaging 0.48
R6913:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R7221:Med13 UTSW 11 86,178,921 (GRCm39) missense probably benign 0.00
R7254:Med13 UTSW 11 86,210,661 (GRCm39) missense probably benign
R7267:Med13 UTSW 11 86,199,652 (GRCm39) missense probably benign 0.01
R7309:Med13 UTSW 11 86,181,888 (GRCm39) missense probably benign 0.00
R7404:Med13 UTSW 11 86,177,272 (GRCm39) missense possibly damaging 0.53
R7586:Med13 UTSW 11 86,161,828 (GRCm39) missense probably damaging 0.99
R7704:Med13 UTSW 11 86,236,744 (GRCm39) nonsense probably null
R7922:Med13 UTSW 11 86,161,831 (GRCm39) missense probably damaging 0.98
R7943:Med13 UTSW 11 86,169,352 (GRCm39) missense probably damaging 0.97
R8062:Med13 UTSW 11 86,210,264 (GRCm39) missense probably benign
R8075:Med13 UTSW 11 86,163,296 (GRCm39) missense probably damaging 0.98
R8207:Med13 UTSW 11 86,194,375 (GRCm39) missense probably damaging 1.00
R9056:Med13 UTSW 11 86,189,660 (GRCm39) nonsense probably null
R9084:Med13 UTSW 11 86,191,621 (GRCm39) missense probably damaging 1.00
R9148:Med13 UTSW 11 86,192,297 (GRCm39) missense probably benign 0.27
R9329:Med13 UTSW 11 86,189,283 (GRCm39) missense probably benign 0.10
R9380:Med13 UTSW 11 86,177,598 (GRCm39) missense probably benign 0.42
R9515:Med13 UTSW 11 86,199,727 (GRCm39) missense probably benign 0.00
R9516:Med13 UTSW 11 86,179,801 (GRCm39) missense probably benign 0.01
R9690:Med13 UTSW 11 86,169,670 (GRCm39) missense probably damaging 1.00
R9751:Med13 UTSW 11 86,189,984 (GRCm39) missense probably damaging 1.00
R9752:Med13 UTSW 11 86,174,147 (GRCm39) missense possibly damaging 0.87
R9764:Med13 UTSW 11 86,177,345 (GRCm39) missense possibly damaging 0.89
Z1176:Med13 UTSW 11 86,246,249 (GRCm39) missense probably damaging 1.00
Z1176:Med13 UTSW 11 86,236,688 (GRCm39) missense probably benign 0.45
Z1176:Med13 UTSW 11 86,219,370 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GAGAACTGTAACTTAATCTTGCAGC -3'
(R):5'- TGTTTAGGCAGCAAAGGGTG -3'

Sequencing Primer
(F):5'- GCAGCAAAATATCCTTTCTTCCCG -3'
(R):5'- CAGCAAAGGGTGTCTCTCTC -3'
Posted On 2021-03-08