Incidental Mutation 'R8671:Prkd1'
ID 661172
Institutional Source Beutler Lab
Gene Symbol Prkd1
Ensembl Gene ENSMUSG00000002688
Gene Name protein kinase D1
Synonyms PKD1, Prkcm, Pkcm
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 50388014-50695881 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50435191 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 512 (N512I)
Ref Sequence ENSEMBL: ENSMUSP00000002765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002765]
AlphaFold Q62101
Predicted Effect probably benign
Transcript: ENSMUST00000002765
AA Change: N512I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000002765
Gene: ENSMUSG00000002688
AA Change: N512I

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
C1 138 194 1.36e-12 SMART
C1 277 326 5.95e-18 SMART
PH 429 549 5.33e-9 SMART
S_TKc 589 845 1.24e-92 SMART
Meta Mutation Damage Score 0.1035 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase involved in many cellular processes, including Golgi body membrane integrity and transport, cell migration and differentiation, MAPK8/JNK1 and Ras pathway signaling, MAPK1/3 (ERK1/2) pathway signaling, cell survival, and regulation of cell shape and adhesion. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality. Mice homozygous for a knock-in allele display partial embryonic and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp369 T C 13: 65,444,095 (GRCm39) S413P possibly damaging Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Prkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prkd1 APN 12 50,430,264 (GRCm39) missense probably damaging 1.00
IGL00727:Prkd1 APN 12 50,411,444 (GRCm39) missense probably damaging 1.00
IGL00772:Prkd1 APN 12 50,430,199 (GRCm39) missense probably damaging 0.99
IGL01092:Prkd1 APN 12 50,430,298 (GRCm39) splice site probably benign
IGL01457:Prkd1 APN 12 50,439,693 (GRCm39) nonsense probably null
IGL01538:Prkd1 APN 12 50,388,925 (GRCm39) missense probably benign
IGL01762:Prkd1 APN 12 50,434,013 (GRCm39) missense probably benign 0.00
IGL01876:Prkd1 APN 12 50,413,131 (GRCm39) missense probably damaging 1.00
IGL01973:Prkd1 APN 12 50,413,162 (GRCm39) missense probably damaging 1.00
IGL02086:Prkd1 APN 12 50,434,046 (GRCm39) missense probably benign
IGL02293:Prkd1 APN 12 50,536,761 (GRCm39) missense probably damaging 0.97
IGL02454:Prkd1 APN 12 50,411,456 (GRCm39) missense probably benign 0.09
IGL03309:Prkd1 APN 12 50,435,207 (GRCm39) missense probably damaging 1.00
R0349:Prkd1 UTSW 12 50,413,139 (GRCm39) missense probably damaging 1.00
R0457:Prkd1 UTSW 12 50,413,155 (GRCm39) missense probably damaging 0.99
R0627:Prkd1 UTSW 12 50,536,824 (GRCm39) missense probably benign 0.00
R0899:Prkd1 UTSW 12 50,431,976 (GRCm39) missense probably damaging 0.98
R1219:Prkd1 UTSW 12 50,435,125 (GRCm39) missense probably damaging 1.00
R1495:Prkd1 UTSW 12 50,413,135 (GRCm39) missense probably damaging 1.00
R1584:Prkd1 UTSW 12 50,472,298 (GRCm39) missense probably damaging 1.00
R1665:Prkd1 UTSW 12 50,441,709 (GRCm39) missense probably damaging 1.00
R1666:Prkd1 UTSW 12 50,441,709 (GRCm39) missense probably damaging 1.00
R1668:Prkd1 UTSW 12 50,441,709 (GRCm39) missense probably damaging 1.00
R1669:Prkd1 UTSW 12 50,441,709 (GRCm39) missense probably damaging 1.00
R1735:Prkd1 UTSW 12 50,388,822 (GRCm39) missense possibly damaging 0.79
R1939:Prkd1 UTSW 12 50,441,777 (GRCm39) missense probably benign 0.00
R2143:Prkd1 UTSW 12 50,536,694 (GRCm39) missense possibly damaging 0.77
R2145:Prkd1 UTSW 12 50,536,694 (GRCm39) missense possibly damaging 0.77
R3404:Prkd1 UTSW 12 50,695,687 (GRCm39) missense unknown
R3801:Prkd1 UTSW 12 50,430,205 (GRCm39) missense possibly damaging 0.89
R3818:Prkd1 UTSW 12 50,466,667 (GRCm39) splice site probably benign
R3906:Prkd1 UTSW 12 50,435,209 (GRCm39) missense possibly damaging 0.91
R3966:Prkd1 UTSW 12 50,439,724 (GRCm39) missense probably benign 0.44
R4179:Prkd1 UTSW 12 50,413,231 (GRCm39) missense probably damaging 1.00
R4510:Prkd1 UTSW 12 50,439,762 (GRCm39) missense possibly damaging 0.81
R4511:Prkd1 UTSW 12 50,439,762 (GRCm39) missense possibly damaging 0.81
R4663:Prkd1 UTSW 12 50,466,631 (GRCm39) splice site probably null
R4896:Prkd1 UTSW 12 50,436,745 (GRCm39) missense probably damaging 1.00
R5070:Prkd1 UTSW 12 50,441,405 (GRCm39) nonsense probably null
R5263:Prkd1 UTSW 12 50,435,089 (GRCm39) missense probably damaging 1.00
R5389:Prkd1 UTSW 12 50,389,920 (GRCm39) missense probably damaging 1.00
R5395:Prkd1 UTSW 12 50,438,215 (GRCm39) missense probably damaging 1.00
R5855:Prkd1 UTSW 12 50,439,699 (GRCm39) missense probably benign 0.03
R5967:Prkd1 UTSW 12 50,411,333 (GRCm39) missense probably damaging 0.99
R5973:Prkd1 UTSW 12 50,435,038 (GRCm39) missense probably damaging 0.99
R6052:Prkd1 UTSW 12 50,413,083 (GRCm39) critical splice donor site probably null
R6063:Prkd1 UTSW 12 50,388,826 (GRCm39) missense probably benign 0.02
R6309:Prkd1 UTSW 12 50,441,443 (GRCm39) nonsense probably null
R6518:Prkd1 UTSW 12 50,472,278 (GRCm39) missense probably benign 0.08
R6868:Prkd1 UTSW 12 50,472,320 (GRCm39) missense probably damaging 1.00
R7256:Prkd1 UTSW 12 50,435,125 (GRCm39) missense possibly damaging 0.88
R7346:Prkd1 UTSW 12 50,695,617 (GRCm39) missense possibly damaging 0.86
R7815:Prkd1 UTSW 12 50,472,300 (GRCm39) missense probably damaging 1.00
R8290:Prkd1 UTSW 12 50,388,799 (GRCm39) missense probably damaging 1.00
R8397:Prkd1 UTSW 12 50,439,675 (GRCm39) missense probably benign
R8805:Prkd1 UTSW 12 50,435,156 (GRCm39) missense probably damaging 0.99
R8805:Prkd1 UTSW 12 50,435,155 (GRCm39) missense probably benign 0.45
R8839:Prkd1 UTSW 12 50,389,616 (GRCm39) intron probably benign
R9005:Prkd1 UTSW 12 50,430,185 (GRCm39) nonsense probably null
R9273:Prkd1 UTSW 12 50,472,232 (GRCm39) missense possibly damaging 0.94
R9281:Prkd1 UTSW 12 50,536,758 (GRCm39) missense probably benign 0.31
R9480:Prkd1 UTSW 12 50,435,283 (GRCm39) missense probably benign 0.19
R9497:Prkd1 UTSW 12 50,438,107 (GRCm39) critical splice donor site probably null
X0024:Prkd1 UTSW 12 50,536,757 (GRCm39) missense probably benign 0.31
X0062:Prkd1 UTSW 12 50,441,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAGCAGCAGGTCTCTTAC -3'
(R):5'- AATCGGCATGATTTTGGTTAACCAC -3'

Sequencing Primer
(F):5'- AGGTCTCTTACTGGACCATCAGGAG -3'
(R):5'- GGTTAACCACATTTACCATTCTTTG -3'
Posted On 2021-03-08