Mutagenetix > Incidental Mutation

Incidental Mutation 'R8671:Catsperb'

661173

Institutional Source

Beutler Lab

Gene Symbol

Catsperb

Ensembl Gene

ENSMUSG00000047014

Gene Name

cation channel sperm associated auxiliary subunit beta

Synonyms

4932415G16Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R8671 (G1)

Quality Score

177.009

Status

Not validated

Chromosome

Chromosomal Location

101404653-101626009 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101594337 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 862 (N862K)

Ref Sequence

ENSEMBL: ENSMUSP00000052089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055156] [ENSMUST00000221241]

AlphaFold

A2RTF1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055156
AA Change: N862K

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000052089
Gene: ENSMUSG00000047014
AA Change: N862K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	73	95	N/A	INTRINSIC
Pfam:CATSPERB	569	1088	1.1e-258	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000221241

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (48/48)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	C	T	4: 73,942,929	E145K	probably damaging	Het
4930430A15Rik	T	C	2: 111,229,532		probably benign	Het
4930467E23Rik	T	A	8: 19,734,759	L203*	probably null	Het
Ambp	A	T	4: 63,150,419	Y120*	probably null	Het
Ankrd36	C	T	11: 5,629,312	A192V	probably benign	Het
Apol7e	A	T	15: 77,717,603	M134L	probably benign	Het
Atg9b	A	T	5: 24,386,109	N774K	probably benign	Het
BC027072	G	T	17: 71,751,377	A435E	probably benign	Het
Ccdc7a	T	A	8: 128,920,467	D648V	probably damaging	Het
Cfap54	G	T	10: 92,955,072	P1855T	unknown	Het
Clcnkb	T	A	4: 141,412,230	T154S	probably damaging	Het
Cux1	C	T	5: 136,250,600	R609H	probably damaging	Het
Eif2ak4	A	G	2: 118,422,186	D413G	possibly damaging	Het
Flnc	T	C	6: 29,443,502		probably null	Het
Grm5	T	C	7: 88,116,290		probably null	Het
Hectd3	T	G	4: 116,996,581	F225V	possibly damaging	Het
Hpcal4	G	T	4: 123,189,183	M107I	probably benign	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ikbkap	A	G	4: 56,771,453	L948P	probably damaging	Het
Larp4	C	A	15: 100,010,458	Q607K	probably benign	Het
March8	A	G	6: 116,401,854	R250G	probably benign	Het
Med13	A	C	11: 86,271,097	N2135K	probably damaging	Het
Msh5	T	A	17: 35,045,933	R89*	probably null	Het
Musk	T	G	4: 58,286,051		probably benign	Het
Myo18b	T	C	5: 112,874,743	Q261R	unknown	Het
Npr1	A	T	3: 90,456,157		probably benign	Het
Nynrin	T	A	14: 55,870,442	V1002E	possibly damaging	Het
Olfr1138	A	T	2: 87,737,646	L226Q	probably damaging	Het
Olfr1195	A	T	2: 88,683,105	F209Y	probably benign	Het
Olfr1315-ps1	T	A	2: 112,110,988	K88M	probably damaging	Het
Olfr167	T	C	16: 19,515,054	Y194C	possibly damaging	Het
Pcdh9	T	C	14: 93,888,650	Y28C	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Prkd1	T	A	12: 50,388,408	N512I	probably benign	Het
Pwwp2b	C	T	7: 139,256,410	P589L	probably damaging	Het
Rasgrp4	G	A	7: 29,143,027	G242D	probably damaging	Het
Rcbtb1	T	G	14: 59,230,524	V480G	probably damaging	Het
Rptn	A	G	3: 93,398,194	S945G	probably benign	Het
Slc22a2	C	T	17: 12,605,976	Q242*	probably null	Het
Slfn3	T	A	11: 83,212,999	V232E	probably benign	Het
Stab1	T	A	14: 31,157,408	K705M	probably damaging	Het
Syn2	C	A	6: 115,278,167	S480*	probably null	Het
Thsd4	A	T	9: 60,394,445	L189H	probably damaging	Het
Tinagl1	T	C	4: 130,167,804	T250A	probably benign	Het
Tnc	A	T	4: 64,017,446	C418S	probably damaging	Het
Ube2q1	A	G	3: 89,776,078	E110G	probably damaging	Het
Wdfy4	G	T	14: 32,971,765		probably benign	Het
Xcl1	T	C	1: 164,931,850	M94V	probably benign	Het
Zfp369	T	C	13: 65,296,281	S413P	possibly damaging	Het
Zfp454	A	C	11: 50,873,768	I279S	possibly damaging	Het
Zfp971	A	C	2: 178,033,937	Q443P	probably damaging	Het

Other mutations in Catsperb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00532:Catsperb	APN	12	101463119	missense	probably damaging	1.00
IGL00580:Catsperb	APN	12	101591529	missense	probably benign	0.01
IGL00661:Catsperb	APN	12	101588098	missense	probably damaging	1.00
IGL00979:Catsperb	APN	12	101415325	missense	probably benign	0.34
IGL01154:Catsperb	APN	12	101625681	missense	possibly damaging	0.79
IGL01360:Catsperb	APN	12	101625254	missense	probably damaging	1.00
IGL01607:Catsperb	APN	12	101480726	splice site	probably benign
IGL01679:Catsperb	APN	12	101591582	splice site	probably null
IGL01827:Catsperb	APN	12	101591540	missense	probably benign	0.00
IGL01866:Catsperb	APN	12	101509311	nonsense	probably null
IGL02161:Catsperb	APN	12	101409415	splice site	probably benign
IGL02177:Catsperb	APN	12	101541462	missense	probably damaging	1.00
IGL02618:Catsperb	APN	12	101480724	splice site	probably benign
IGL02721:Catsperb	APN	12	101625297	missense	probably null	1.00
IGL02828:Catsperb	APN	12	101480782	missense	probably benign	0.00
BB001:Catsperb	UTSW	12	101520565	missense	probably benign	0.02
BB011:Catsperb	UTSW	12	101520565	missense	probably benign	0.02
R0571:Catsperb	UTSW	12	101602774	missense	possibly damaging	0.72
R0727:Catsperb	UTSW	12	101594355	splice site	probably null
R0842:Catsperb	UTSW	12	101463048	missense	probably damaging	1.00
R1187:Catsperb	UTSW	12	101625732	missense	probably benign	0.07
R1432:Catsperb	UTSW	12	101622217	missense	probably damaging	1.00
R1449:Catsperb	UTSW	12	101588197	missense	probably benign	0.09
R1488:Catsperb	UTSW	12	101594267	missense	probably damaging	0.97
R1540:Catsperb	UTSW	12	101412330	missense	probably benign	0.02
R1560:Catsperb	UTSW	12	101625726	missense	probably benign	0.01
R1563:Catsperb	UTSW	12	101588102	missense	probably damaging	1.00
R1583:Catsperb	UTSW	12	101463114	missense	probably damaging	0.96
R1989:Catsperb	UTSW	12	101602711	missense	probably damaging	1.00
R1993:Catsperb	UTSW	12	101602767	missense	possibly damaging	0.86
R1995:Catsperb	UTSW	12	101602767	missense	possibly damaging	0.86
R2037:Catsperb	UTSW	12	101507962	missense	probably damaging	1.00
R2186:Catsperb	UTSW	12	101480782	missense	probably benign	0.00
R2217:Catsperb	UTSW	12	101594219	missense	probably damaging	0.99
R2391:Catsperb	UTSW	12	101624706	missense	probably damaging	1.00
R2679:Catsperb	UTSW	12	101463145	missense	probably damaging	1.00
R3848:Catsperb	UTSW	12	101509326	missense	probably damaging	0.98
R4023:Catsperb	UTSW	12	101602683	nonsense	probably null
R4507:Catsperb	UTSW	12	101480828	critical splice donor site	probably null
R4558:Catsperb	UTSW	12	101591540	missense	possibly damaging	0.94
R4649:Catsperb	UTSW	12	101541512	missense	probably benign	0.01
R4651:Catsperb	UTSW	12	101541512	missense	probably benign	0.01
R4866:Catsperb	UTSW	12	101507949	missense	probably damaging	1.00
R4873:Catsperb	UTSW	12	101587985	missense	possibly damaging	0.90
R4875:Catsperb	UTSW	12	101587985	missense	possibly damaging	0.90
R4897:Catsperb	UTSW	12	101602766	missense	probably damaging	0.98
R5002:Catsperb	UTSW	12	101520554	missense	probably benign
R5137:Catsperb	UTSW	12	101549811	missense	probably damaging	0.96
R5396:Catsperb	UTSW	12	101594284	missense	possibly damaging	0.90
R5450:Catsperb	UTSW	12	101446068	missense	possibly damaging	0.92
R5484:Catsperb	UTSW	12	101575916	missense	probably benign	0.38
R5846:Catsperb	UTSW	12	101602766	missense	probably damaging	0.98
R5905:Catsperb	UTSW	12	101602700	missense	possibly damaging	0.69
R5906:Catsperb	UTSW	12	101510462	missense	probably damaging	1.00
R6034:Catsperb	UTSW	12	101575832	missense	probably benign
R6034:Catsperb	UTSW	12	101575832	missense	probably benign
R6149:Catsperb	UTSW	12	101549839	missense	probably damaging	1.00
R6165:Catsperb	UTSW	12	101575816	missense	possibly damaging	0.90
R6210:Catsperb	UTSW	12	101412568	splice site	probably null
R6297:Catsperb	UTSW	12	101591396	splice site	probably null
R6302:Catsperb	UTSW	12	101588143	missense	possibly damaging	0.95
R6681:Catsperb	UTSW	12	101624735	nonsense	probably null
R6698:Catsperb	UTSW	12	101509207	missense	probably damaging	1.00
R6869:Catsperb	UTSW	12	101480737	missense	probably benign	0.09
R6948:Catsperb	UTSW	12	101481068	missense	probably benign	0.00
R7035:Catsperb	UTSW	12	101415334	missense	probably damaging	1.00
R7073:Catsperb	UTSW	12	101509238	missense	probably benign	0.09
R7100:Catsperb	UTSW	12	101446038	missense	possibly damaging	0.83
R7338:Catsperb	UTSW	12	101480984	missense	probably benign	0.08
R7397:Catsperb	UTSW	12	101588023	missense	possibly damaging	0.84
R7413:Catsperb	UTSW	12	101481048	missense	probably damaging	1.00
R7422:Catsperb	UTSW	12	101588034	missense	probably damaging	1.00
R7425:Catsperb	UTSW	12	101591498	missense	probably damaging	0.96
R7578:Catsperb	UTSW	12	101588285	missense	probably benign	0.01
R7924:Catsperb	UTSW	12	101520565	missense	probably benign	0.02
R8021:Catsperb	UTSW	12	101588063	missense	probably benign	0.22
R8060:Catsperb	UTSW	12	101602766	missense	probably damaging	0.98
R8167:Catsperb	UTSW	12	101591455	missense	probably benign	0.00
R8323:Catsperb	UTSW	12	101409399	missense	probably benign	0.02
R8425:Catsperb	UTSW	12	101602769	missense	probably benign
R8547:Catsperb	UTSW	12	101446046	missense	probably damaging	1.00
R8906:Catsperb	UTSW	12	101520645	missense	possibly damaging	0.92
R9227:Catsperb	UTSW	12	101549794	missense	probably benign
R9230:Catsperb	UTSW	12	101549794	missense	probably benign
R9298:Catsperb	UTSW	12	101594341	missense	possibly damaging	0.91
RF006:Catsperb	UTSW	12	101575979	critical splice donor site	probably null
Z1177:Catsperb	UTSW	12	101446048	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCACTTCAATAGCACTGGTTC -3'
(R):5'- AGGCGCTGTAGCTAGATTTC -3'

Sequencing Primer
(F):5'- CACTTCAATAGCACTGGTTCTTTGGG -3'
(R):5'- TTTCCAATGCTATACCAAAAGTCC -3'

Posted On

2021-03-08