Incidental Mutation 'R8671:Catsperb'
ID 661173
Institutional Source Beutler Lab
Gene Symbol Catsperb
Ensembl Gene ENSMUSG00000047014
Gene Name cation channel sperm associated auxiliary subunit beta
Synonyms 4932415G16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R8671 (G1)
Quality Score 177.009
Status Not validated
Chromosome 12
Chromosomal Location 101404653-101626009 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 101594337 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 862 (N862K)
Ref Sequence ENSEMBL: ENSMUSP00000052089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055156] [ENSMUST00000221241]
AlphaFold A2RTF1
Predicted Effect possibly damaging
Transcript: ENSMUST00000055156
AA Change: N862K

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052089
Gene: ENSMUSG00000047014
AA Change: N862K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Pfam:CATSPERB 569 1088 1.1e-258 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221241
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,942,929 E145K probably damaging Het
4930430A15Rik T C 2: 111,229,532 probably benign Het
4930467E23Rik T A 8: 19,734,759 L203* probably null Het
Ambp A T 4: 63,150,419 Y120* probably null Het
Ankrd36 C T 11: 5,629,312 A192V probably benign Het
Apol7e A T 15: 77,717,603 M134L probably benign Het
Atg9b A T 5: 24,386,109 N774K probably benign Het
BC027072 G T 17: 71,751,377 A435E probably benign Het
Ccdc7a T A 8: 128,920,467 D648V probably damaging Het
Cfap54 G T 10: 92,955,072 P1855T unknown Het
Clcnkb T A 4: 141,412,230 T154S probably damaging Het
Cux1 C T 5: 136,250,600 R609H probably damaging Het
Eif2ak4 A G 2: 118,422,186 D413G possibly damaging Het
Flnc T C 6: 29,443,502 probably null Het
Grm5 T C 7: 88,116,290 probably null Het
Hectd3 T G 4: 116,996,581 F225V possibly damaging Het
Hpcal4 G T 4: 123,189,183 M107I probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ikbkap A G 4: 56,771,453 L948P probably damaging Het
Larp4 C A 15: 100,010,458 Q607K probably benign Het
March8 A G 6: 116,401,854 R250G probably benign Het
Med13 A C 11: 86,271,097 N2135K probably damaging Het
Msh5 T A 17: 35,045,933 R89* probably null Het
Musk T G 4: 58,286,051 probably benign Het
Myo18b T C 5: 112,874,743 Q261R unknown Het
Npr1 A T 3: 90,456,157 probably benign Het
Nynrin T A 14: 55,870,442 V1002E possibly damaging Het
Olfr1138 A T 2: 87,737,646 L226Q probably damaging Het
Olfr1195 A T 2: 88,683,105 F209Y probably benign Het
Olfr1315-ps1 T A 2: 112,110,988 K88M probably damaging Het
Olfr167 T C 16: 19,515,054 Y194C possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prkd1 T A 12: 50,388,408 N512I probably benign Het
Pwwp2b C T 7: 139,256,410 P589L probably damaging Het
Rasgrp4 G A 7: 29,143,027 G242D probably damaging Het
Rcbtb1 T G 14: 59,230,524 V480G probably damaging Het
Rptn A G 3: 93,398,194 S945G probably benign Het
Slc22a2 C T 17: 12,605,976 Q242* probably null Het
Slfn3 T A 11: 83,212,999 V232E probably benign Het
Stab1 T A 14: 31,157,408 K705M probably damaging Het
Syn2 C A 6: 115,278,167 S480* probably null Het
Thsd4 A T 9: 60,394,445 L189H probably damaging Het
Tinagl1 T C 4: 130,167,804 T250A probably benign Het
Tnc A T 4: 64,017,446 C418S probably damaging Het
Ube2q1 A G 3: 89,776,078 E110G probably damaging Het
Wdfy4 G T 14: 32,971,765 probably benign Het
Xcl1 T C 1: 164,931,850 M94V probably benign Het
Zfp369 T C 13: 65,296,281 S413P possibly damaging Het
Zfp454 A C 11: 50,873,768 I279S possibly damaging Het
Zfp971 A C 2: 178,033,937 Q443P probably damaging Het
Other mutations in Catsperb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Catsperb APN 12 101463119 missense probably damaging 1.00
IGL00580:Catsperb APN 12 101591529 missense probably benign 0.01
IGL00661:Catsperb APN 12 101588098 missense probably damaging 1.00
IGL00979:Catsperb APN 12 101415325 missense probably benign 0.34
IGL01154:Catsperb APN 12 101625681 missense possibly damaging 0.79
IGL01360:Catsperb APN 12 101625254 missense probably damaging 1.00
IGL01607:Catsperb APN 12 101480726 splice site probably benign
IGL01679:Catsperb APN 12 101591582 splice site probably null
IGL01827:Catsperb APN 12 101591540 missense probably benign 0.00
IGL01866:Catsperb APN 12 101509311 nonsense probably null
IGL02161:Catsperb APN 12 101409415 splice site probably benign
IGL02177:Catsperb APN 12 101541462 missense probably damaging 1.00
IGL02618:Catsperb APN 12 101480724 splice site probably benign
IGL02721:Catsperb APN 12 101625297 missense probably null 1.00
IGL02828:Catsperb APN 12 101480782 missense probably benign 0.00
BB001:Catsperb UTSW 12 101520565 missense probably benign 0.02
BB011:Catsperb UTSW 12 101520565 missense probably benign 0.02
R0571:Catsperb UTSW 12 101602774 missense possibly damaging 0.72
R0727:Catsperb UTSW 12 101594355 splice site probably null
R0842:Catsperb UTSW 12 101463048 missense probably damaging 1.00
R1187:Catsperb UTSW 12 101625732 missense probably benign 0.07
R1432:Catsperb UTSW 12 101622217 missense probably damaging 1.00
R1449:Catsperb UTSW 12 101588197 missense probably benign 0.09
R1488:Catsperb UTSW 12 101594267 missense probably damaging 0.97
R1540:Catsperb UTSW 12 101412330 missense probably benign 0.02
R1560:Catsperb UTSW 12 101625726 missense probably benign 0.01
R1563:Catsperb UTSW 12 101588102 missense probably damaging 1.00
R1583:Catsperb UTSW 12 101463114 missense probably damaging 0.96
R1989:Catsperb UTSW 12 101602711 missense probably damaging 1.00
R1993:Catsperb UTSW 12 101602767 missense possibly damaging 0.86
R1995:Catsperb UTSW 12 101602767 missense possibly damaging 0.86
R2037:Catsperb UTSW 12 101507962 missense probably damaging 1.00
R2186:Catsperb UTSW 12 101480782 missense probably benign 0.00
R2217:Catsperb UTSW 12 101594219 missense probably damaging 0.99
R2391:Catsperb UTSW 12 101624706 missense probably damaging 1.00
R2679:Catsperb UTSW 12 101463145 missense probably damaging 1.00
R3848:Catsperb UTSW 12 101509326 missense probably damaging 0.98
R4023:Catsperb UTSW 12 101602683 nonsense probably null
R4507:Catsperb UTSW 12 101480828 critical splice donor site probably null
R4558:Catsperb UTSW 12 101591540 missense possibly damaging 0.94
R4649:Catsperb UTSW 12 101541512 missense probably benign 0.01
R4651:Catsperb UTSW 12 101541512 missense probably benign 0.01
R4866:Catsperb UTSW 12 101507949 missense probably damaging 1.00
R4873:Catsperb UTSW 12 101587985 missense possibly damaging 0.90
R4875:Catsperb UTSW 12 101587985 missense possibly damaging 0.90
R4897:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R5002:Catsperb UTSW 12 101520554 missense probably benign
R5137:Catsperb UTSW 12 101549811 missense probably damaging 0.96
R5396:Catsperb UTSW 12 101594284 missense possibly damaging 0.90
R5450:Catsperb UTSW 12 101446068 missense possibly damaging 0.92
R5484:Catsperb UTSW 12 101575916 missense probably benign 0.38
R5846:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R5905:Catsperb UTSW 12 101602700 missense possibly damaging 0.69
R5906:Catsperb UTSW 12 101510462 missense probably damaging 1.00
R6034:Catsperb UTSW 12 101575832 missense probably benign
R6034:Catsperb UTSW 12 101575832 missense probably benign
R6149:Catsperb UTSW 12 101549839 missense probably damaging 1.00
R6165:Catsperb UTSW 12 101575816 missense possibly damaging 0.90
R6210:Catsperb UTSW 12 101412568 splice site probably null
R6297:Catsperb UTSW 12 101591396 splice site probably null
R6302:Catsperb UTSW 12 101588143 missense possibly damaging 0.95
R6681:Catsperb UTSW 12 101624735 nonsense probably null
R6698:Catsperb UTSW 12 101509207 missense probably damaging 1.00
R6869:Catsperb UTSW 12 101480737 missense probably benign 0.09
R6948:Catsperb UTSW 12 101481068 missense probably benign 0.00
R7035:Catsperb UTSW 12 101415334 missense probably damaging 1.00
R7073:Catsperb UTSW 12 101509238 missense probably benign 0.09
R7100:Catsperb UTSW 12 101446038 missense possibly damaging 0.83
R7338:Catsperb UTSW 12 101480984 missense probably benign 0.08
R7397:Catsperb UTSW 12 101588023 missense possibly damaging 0.84
R7413:Catsperb UTSW 12 101481048 missense probably damaging 1.00
R7422:Catsperb UTSW 12 101588034 missense probably damaging 1.00
R7425:Catsperb UTSW 12 101591498 missense probably damaging 0.96
R7578:Catsperb UTSW 12 101588285 missense probably benign 0.01
R7924:Catsperb UTSW 12 101520565 missense probably benign 0.02
R8021:Catsperb UTSW 12 101588063 missense probably benign 0.22
R8060:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R8167:Catsperb UTSW 12 101591455 missense probably benign 0.00
R8323:Catsperb UTSW 12 101409399 missense probably benign 0.02
R8425:Catsperb UTSW 12 101602769 missense probably benign
R8547:Catsperb UTSW 12 101446046 missense probably damaging 1.00
R8906:Catsperb UTSW 12 101520645 missense possibly damaging 0.92
R9227:Catsperb UTSW 12 101549794 missense probably benign
R9230:Catsperb UTSW 12 101549794 missense probably benign
R9298:Catsperb UTSW 12 101594341 missense possibly damaging 0.91
RF006:Catsperb UTSW 12 101575979 critical splice donor site probably null
Z1177:Catsperb UTSW 12 101446048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTTCAATAGCACTGGTTC -3'
(R):5'- AGGCGCTGTAGCTAGATTTC -3'

Sequencing Primer
(F):5'- CACTTCAATAGCACTGGTTCTTTGGG -3'
(R):5'- TTTCCAATGCTATACCAAAAGTCC -3'
Posted On 2021-03-08