Incidental Mutation 'R8671:Zfp369'
ID 661174
Institutional Source Beutler Lab
Gene Symbol Zfp369
Ensembl Gene ENSMUSG00000021514
Gene Name zinc finger protein 369
Synonyms B930030B22Rik, NRIF2, D230020H11Rik
MMRRC Submission 068526-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 65426628-65452035 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65444095 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 413 (S413P)
Ref Sequence ENSEMBL: ENSMUSP00000119114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126879] [ENSMUST00000130799]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000126879
AA Change: S413P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119114
Gene: ENSMUSG00000021514
AA Change: S413P

DomainStartEndE-ValueType
KRAB 35 95 7.13e-20 SMART
SCAN 178 289 2.57e-39 SMART
KRAB 300 367 1.63e-14 SMART
low complexity region 440 452 N/A INTRINSIC
ZnF_C2H2 701 723 5.42e-2 SMART
ZnF_C2H2 729 751 4.79e-3 SMART
ZnF_C2H2 757 779 1.47e-3 SMART
ZnF_C2H2 785 807 2.43e-4 SMART
ZnF_C2H2 813 835 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130799
SMART Domains Protein: ENSMUSP00000116221
Gene: ENSMUSG00000021514

DomainStartEndE-ValueType
KRAB 35 95 7.13e-20 SMART
SCAN 178 289 2.57e-39 SMART
KRAB 300 354 3.54e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,861,166 (GRCm39) E145K probably damaging Het
Ambp A T 4: 63,068,656 (GRCm39) Y120* probably null Het
Ankrd36 C T 11: 5,579,312 (GRCm39) A192V probably benign Het
Apol7e A T 15: 77,601,803 (GRCm39) M134L probably benign Het
Atg9b A T 5: 24,591,107 (GRCm39) N774K probably benign Het
Catsperb T A 12: 101,560,596 (GRCm39) N862K possibly damaging Het
Ccdc7a T A 8: 129,646,948 (GRCm39) D648V probably damaging Het
Cfap54 G T 10: 92,790,934 (GRCm39) P1855T unknown Het
Clcnkb T A 4: 141,139,541 (GRCm39) T154S probably damaging Het
Cux1 C T 5: 136,279,454 (GRCm39) R609H probably damaging Het
Eif2ak4 A G 2: 118,252,667 (GRCm39) D413G possibly damaging Het
Elp1 A G 4: 56,771,453 (GRCm39) L948P probably damaging Het
Flnc T C 6: 29,443,501 (GRCm39) probably null Het
Grm5 T C 7: 87,765,498 (GRCm39) probably null Het
Hectd3 T G 4: 116,853,778 (GRCm39) F225V possibly damaging Het
Hpcal4 G T 4: 123,082,976 (GRCm39) M107I probably benign Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Larp4 C A 15: 99,908,339 (GRCm39) Q607K probably benign Het
Marchf8 A G 6: 116,378,815 (GRCm39) R250G probably benign Het
Med13 A C 11: 86,161,923 (GRCm39) N2135K probably damaging Het
Msh5 T A 17: 35,264,909 (GRCm39) R89* probably null Het
Musk T G 4: 58,286,051 (GRCm39) probably benign Het
Myo18b T C 5: 113,022,609 (GRCm39) Q261R unknown Het
Npr1 A T 3: 90,363,464 (GRCm39) probably benign Het
Nynrin T A 14: 56,107,899 (GRCm39) V1002E possibly damaging Het
Or2l5 T C 16: 19,333,804 (GRCm39) Y194C possibly damaging Het
Or4c103 A T 2: 88,513,449 (GRCm39) F209Y probably benign Het
Or4f14c T A 2: 111,941,333 (GRCm39) K88M probably damaging Het
Or5w15 A T 2: 87,567,990 (GRCm39) L226Q probably damaging Het
Pcare G T 17: 72,058,372 (GRCm39) A435E probably benign Het
Pcdh9 T C 14: 94,126,086 (GRCm39) Y28C probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Potefam1 T C 2: 111,059,877 (GRCm39) probably benign Het
Potefam3e T A 8: 19,784,775 (GRCm39) L203* probably null Het
Prkd1 T A 12: 50,435,191 (GRCm39) N512I probably benign Het
Pwwp2b C T 7: 138,836,326 (GRCm39) P589L probably damaging Het
Rasgrp4 G A 7: 28,842,452 (GRCm39) G242D probably damaging Het
Rcbtb1 T G 14: 59,467,973 (GRCm39) V480G probably damaging Het
Rptn A G 3: 93,305,501 (GRCm39) S945G probably benign Het
Slc22a2 C T 17: 12,824,863 (GRCm39) Q242* probably null Het
Slfn3 T A 11: 83,103,825 (GRCm39) V232E probably benign Het
Stab1 T A 14: 30,879,365 (GRCm39) K705M probably damaging Het
Syn2 C A 6: 115,255,128 (GRCm39) S480* probably null Het
Thsd4 A T 9: 60,301,728 (GRCm39) L189H probably damaging Het
Tinagl1 T C 4: 130,061,597 (GRCm39) T250A probably benign Het
Tnc A T 4: 63,935,683 (GRCm39) C418S probably damaging Het
Ube2q1 A G 3: 89,683,385 (GRCm39) E110G probably damaging Het
Wdfy4 G T 14: 32,693,722 (GRCm39) probably benign Het
Xcl1 T C 1: 164,759,419 (GRCm39) M94V probably benign Het
Zfp454 A C 11: 50,764,595 (GRCm39) I279S possibly damaging Het
Zfp971 A C 2: 177,675,730 (GRCm39) Q443P probably damaging Het
Other mutations in Zfp369
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Zfp369 APN 13 65,445,074 (GRCm39) missense probably benign 0.41
IGL01393:Zfp369 APN 13 65,442,288 (GRCm39) missense possibly damaging 0.85
IGL02277:Zfp369 APN 13 65,432,746 (GRCm39) missense probably damaging 1.00
IGL02986:Zfp369 APN 13 65,428,095 (GRCm39) missense probably damaging 1.00
IGL02992:Zfp369 APN 13 65,442,265 (GRCm39) missense possibly damaging 0.50
IGL03170:Zfp369 APN 13 65,442,224 (GRCm39) missense probably damaging 0.99
IGL03351:Zfp369 APN 13 65,443,967 (GRCm39) missense possibly damaging 0.95
R0136:Zfp369 UTSW 13 65,445,016 (GRCm39) missense probably benign 0.08
R0600:Zfp369 UTSW 13 65,444,248 (GRCm39) missense probably damaging 0.97
R0646:Zfp369 UTSW 13 65,445,362 (GRCm39) missense probably damaging 1.00
R1190:Zfp369 UTSW 13 65,440,107 (GRCm39) missense probably damaging 0.99
R1191:Zfp369 UTSW 13 65,439,776 (GRCm39) nonsense probably null
R1528:Zfp369 UTSW 13 65,439,979 (GRCm39) missense probably damaging 1.00
R1934:Zfp369 UTSW 13 65,444,965 (GRCm39) missense probably damaging 1.00
R2168:Zfp369 UTSW 13 65,444,762 (GRCm39) missense probably benign 0.01
R4386:Zfp369 UTSW 13 65,444,806 (GRCm39) missense probably benign 0.00
R4928:Zfp369 UTSW 13 65,444,614 (GRCm39) missense possibly damaging 0.91
R5127:Zfp369 UTSW 13 65,426,847 (GRCm39) start gained probably benign
R5549:Zfp369 UTSW 13 65,445,194 (GRCm39) missense probably damaging 1.00
R5740:Zfp369 UTSW 13 65,444,581 (GRCm39) missense probably benign
R5743:Zfp369 UTSW 13 65,443,494 (GRCm39) missense probably benign 0.02
R5840:Zfp369 UTSW 13 65,445,092 (GRCm39) missense possibly damaging 0.46
R6351:Zfp369 UTSW 13 65,444,044 (GRCm39) missense possibly damaging 0.83
R7248:Zfp369 UTSW 13 65,443,931 (GRCm39) missense probably damaging 0.98
R7288:Zfp369 UTSW 13 65,432,832 (GRCm39) critical splice donor site probably null
R7314:Zfp369 UTSW 13 65,439,918 (GRCm39) missense probably damaging 0.97
R7470:Zfp369 UTSW 13 65,439,960 (GRCm39) missense probably benign 0.12
R7508:Zfp369 UTSW 13 65,427,087 (GRCm39) missense unknown
R7796:Zfp369 UTSW 13 65,444,029 (GRCm39) missense probably benign
R7886:Zfp369 UTSW 13 65,439,868 (GRCm39) missense possibly damaging 0.95
R8425:Zfp369 UTSW 13 65,444,489 (GRCm39) missense possibly damaging 0.96
R8868:Zfp369 UTSW 13 65,445,082 (GRCm39) missense possibly damaging 0.60
R8918:Zfp369 UTSW 13 65,443,529 (GRCm39) nonsense probably null
R8921:Zfp369 UTSW 13 65,444,044 (GRCm39) missense possibly damaging 0.92
R9201:Zfp369 UTSW 13 65,444,396 (GRCm39) missense probably benign 0.07
R9236:Zfp369 UTSW 13 65,445,010 (GRCm39) missense probably benign 0.08
R9443:Zfp369 UTSW 13 65,444,347 (GRCm39) missense possibly damaging 0.93
Z1177:Zfp369 UTSW 13 65,439,974 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACTCTCCCATACCTGTGG -3'
(R):5'- ATGTGTCACAGGAGTGCTG -3'

Sequencing Primer
(F):5'- GACTCTCCCATACCTGTGGTAAAG -3'
(R):5'- CACGGAGTCCTTCTGCTG -3'
Posted On 2021-03-08